EPHA4-EPH receptor A4 Gene View larger

EPHA4-EPH receptor A4 Gene

PTXBC016981

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EPHA4-EPH receptor A4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EPHA4-EPH receptor A4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016981
Product type: DNA & cDNA
Ncbi symbol: EPHA4
Origin species: Human
Product name: EPHA4-EPH receptor A4 Gene
Size: 2ug
Accessions: BC016981
Gene id: 2043
Gene description: EPH receptor A4
Synonyms: HEK8; SEK; TYRO1; ephrin type-A receptor 4; EK8; EPH-like kinase 8; TYRO1 protein tyrosine kinase; receptor protein-tyrosine kinase HEK8; tyrosine-protein kinase TYRO1; tyrosine-protein kinase receptor SEK; EPH receptor A4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtgtacataggtgtgagtgtgtgtgtatgcgtgcctgtctgtgtgcgggtgtgtgtatgtgcatagcctcatgcttaggactacccatgaatgttgtggaatgctacacctggagagttctggttttccaccagtttcaagatgaagaactacatgatacagtggacctggagaccatccccttggaaagacaacccagagatgttcagcatcctgtatctacacgcatcctgtatctacacgtgtattttgtagctgtcacactaaccttaataagaattctacagctttggacagaggcattttcaccttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G antigen 12I
- cystatin 9-like
- riboflavin kinase
- peroxiredoxin 1

Buy EPHA4-EPH receptor A4 Gene now

Add to cart