C9orf80-chromosome 9 open reading frame 80 Gene View larger

C9orf80-chromosome 9 open reading frame 80 Gene

PTXBC014881

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf80-chromosome 9 open reading frame 80 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf80-chromosome 9 open reading frame 80 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014881
Product type: DNA & cDNA
Ncbi symbol: C9orf80
Origin species: Human
Product name: C9orf80-chromosome 9 open reading frame 80 Gene
Size: 2ug
Accessions: BC014881
Gene id: 58493
Gene description: chromosome 9 open reading frame 80
Synonyms: C9orf80; HSPC043; MISE; SOSSC; SSBIP1; hSSBIP1; SOSS complex subunit C; SSB-interacting protein 1; hSSB-interacting protein 1; minute INTS3/hSSB-associated element; sensor of single-strand DNA complex subunit C; sensor of ssDNA subunit C; single-stranded DNA-binding protein-interacting protein 1; INTS3 and NABP interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcaaactcttcaggacaaggttttcaaaacaaaaatagagttgcaatcttggcagaactggacaaagagaaaagaaaactacttatgcagaaccagtcttcaacaaatcatcctggagctagcattgcactctcgagaccctctcttaataaggacttccgggatcacgctgagcagcagcatattgcagcccaacagaaggcagctttgcagcatgctcatgcacattcatctggatacttcatcactcaagactctgcatttgggaaccttattcttcctgttttacctcgccttgacccagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S33
- alpha-2-glycoprotein 1, zinc-binding
- chromosome 2 open reading frame 58
- chromosome 5 open reading frame 36

Buy C9orf80-chromosome 9 open reading frame 80 Gene now

Add to cart