TMCO5A-transmembrane and coiled-coil domains 5A Gene View larger

TMCO5A-transmembrane and coiled-coil domains 5A Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMCO5A-transmembrane and coiled-coil domains 5A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMCO5A-transmembrane and coiled-coil domains 5A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029221
Product type: DNA & cDNA
Ncbi symbol: TMCO5A
Origin species: Human
Product name: TMCO5A-transmembrane and coiled-coil domains 5A Gene
Size: 2ug
Accessions: BC029221
Gene id: 145942
Gene description: transmembrane and coiled-coil domains 5A
Synonyms: TMCO5; transmembrane and coiled-coil domain-containing protein 5A; testicular tissue protein Li 205; transmembrane and coiled-coil domains 5; transmembrane and coiled-coil domains 5A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaatctcaagattggctcagtcaaaaagaaacattatcagtttgaacatggaccttgaaagggatacgcagagaatagatgaagcaaaccagaaacttcttctcaaaatccaagagagggaagataagattcagaggctggaaagtgagatcattcagacgcggggcctggtggaagatgaagagtgggagaaggagaaccgcaccacgatggaaagggaaagagccttgcaggagctggaggaagaaacagccagacttgaaaggaagaataagacgttggtccacagtataacagaacttcaacaaaagcttacaaggaaatcacaaaagataaccaattgtgaacaaagcagtccagatggagccctagaagagacaaaggttaagttacaacagctggaagcttcctatgcatgccaagagaaggagctgctcaaggtaatgaaggagtatgcatttgtgacccagctctgtgaagatcaagccctctacataaagaagtaccaggaaacgttgaagaaaatagaagaagaactagaggctctgttccttgagagagaagtatcaaaactcgtgagcatgaaccctgtggaaaaagagcataccagccaaaataatgagggtactcctacccaaaagacagcaagattattcagtaaaaagattttttgctgtctctttttcatcaccctatttttcatcagactgctgagctacatgttttttcatgtaagattcataaatccagatctcctcgtcaatgtactgcccaaggtactgggcaggagcaccttgtggaagctcagatgcttcttctttccatctctcacacttgagacagaggacatgttaccccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cholinergic receptor, nicotinic, alpha 7
- limbic system-associated membrane protein
- Rab interacting lysosomal protein-like 2
- phospholipase A2, group IVD (cytosolic)

Buy TMCO5A-transmembrane and coiled-coil domains 5A Gene now

Add to cart