Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ACYP2-acylphosphatase 2, muscle type Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ACYP2-acylphosphatase 2, muscle type Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012290 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACYP2 |
| Origin species: | Human |
| Product name: | ACYP2-acylphosphatase 2, muscle type Gene |
| Size: | 2ug |
| Accessions: | BC012290 |
| Gene id: | 98 |
| Gene description: | acylphosphatase 2, muscle type |
| Synonyms: | ACYM; ACYP; acylphosphatase-2; acylphosphatase 2, muscle type; acylphosphatase, muscle type isozyme; acylphosphate phosphohydrolase 2; testicular tissue protein Li 11; acylphosphatase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctaccgcccagtcactcaaatccgtggactacgaggtgttcggaagagtgcagggtgtttgcttcagaatgtatacagaagatgaagctaggaaaataggagtggttggctgggtgaagaataccagcaaaggcaccgtgacaggccaagtgcaggggccagaagacaaagtcaattccatgaagtcctggctgagcaaggttggaagccctagttctcgcattgaccgcacaaacttttctaatgaaaaaaccatctctaagcttgaatactctaattttagtattagatactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dual specificity phosphatase 3 - FK506 binding protein 6, 36kDa - dihydropyrimidine dehydrogenase - ribosomal protein S4, X-linked |