C19orf53-chromosome 19 open reading frame 53 Gene View larger

C19orf53-chromosome 19 open reading frame 53 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf53-chromosome 19 open reading frame 53 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf53-chromosome 19 open reading frame 53 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015465
Product type: DNA & cDNA
Ncbi symbol: C19orf53
Origin species: Human
Product name: C19orf53-chromosome 19 open reading frame 53 Gene
Size: 2ug
Accessions: BC015465
Gene id: 28974
Gene description: chromosome 19 open reading frame 53
Synonyms: HSPC023; LYDG10; leydig cell tumor 10 kDa protein homolog; chromosome 19 open reading frame 53
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcaggggcagcgcaagtttcaggcgcacaaacccgcaaagagtaagacggcagcggcagcctctgaaaagaatcggggcccaagaaaaggcggtcgtgttatcgctcccaagaaggcgcgcgtcgtgcagcagcaaaagctcaagaagaacctagaagtcggaatccggaagaagatcgaacatgacgtggtgatgaaagccagcagcagcctgcccaagaagctggcactgctgaaggccccagccaagaagaaaggggcagctgccgccacctcctccaagacaccttcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 16 open reading frame 14
- chromosome 17 open reading frame 61
- chromosome 1 open reading frame 109
- mitochondrial ribosomal protein S18C

Buy C19orf53-chromosome 19 open reading frame 53 Gene now

Add to cart