C17orf61-chromosome 17 open reading frame 61 Gene View larger

C17orf61-chromosome 17 open reading frame 61 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C17orf61-chromosome 17 open reading frame 61 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C17orf61-chromosome 17 open reading frame 61 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030270
Product type: DNA & cDNA
Ncbi symbol: C17orf61
Origin species: Human
Product name: C17orf61-chromosome 17 open reading frame 61 Gene
Size: 2ug
Accessions: BC030270
Gene id: 254863
Gene description: chromosome 17 open reading frame 61
Synonyms: UPF0451 protein C17orf61; C17orf61; transmembrane protein 256
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgggccagctgcagctttccgccgcttgggcgccttgtccggagctgcggccttaggcttcgcttcctacggggcgcacggcgcccaattcccagatgcctacgggaaggagctgtttgacaaggccaacaaacaccacttcttacacagcctggccctgttaggggtgccccattgcagaaagccactctgggctgggttattgctagcttccggaacgaccttattctgcaccagcttttactaccaggctctgagtggagaccccagcatccagactttggcccctgcgggagggaccctgctactcttgggctggcttgccttggctctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 109
- mitochondrial ribosomal protein S18C
- chromosome 10 open reading frame 53
- chromosome 9 open reading frame 100

Buy C17orf61-chromosome 17 open reading frame 61 Gene now

Add to cart