Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MRPS18C-mitochondrial ribosomal protein S18C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPS18C-mitochondrial ribosomal protein S18C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005186 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPS18C |
| Origin species: | Human |
| Product name: | MRPS18C-mitochondrial ribosomal protein S18C Gene |
| Size: | 2ug |
| Accessions: | BC005186 |
| Gene id: | 51023 |
| Gene description: | mitochondrial ribosomal protein S18C |
| Synonyms: | CGI-134; MRP-S18-1; MRP-S18-c; MRPS18-1; S18mt-c; mrps18-c; 28S ribosomal protein S18c, mitochondrial; 28S ribosomal protein S18-1, mitochondrial; mitochondrial ribosomal protein S18-1; mitochondrial ribosomal protein S18C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgctgtggttgctgtttgcggtggtctagggaggaagaagttgacacacttggtaacggctgctgtcagccttacacatcccgggactcacacggtgctttggagaagaggttgttcacaacaggtatccagcaatgaggacctgcccatttcaatggaaaatccttataaagaacctcttaagaaatgtatcttgtgtggaaagcatgtagattataagaatgtacagcttttgtcccagtttgtttctccatttactggatgcatttatggaaggcacattacaggtctttgtgggaagaaacagaaagaaatcacaaaagcaattaagagagctcaaataatggggtttatgccagttacatacaaggatcctgcatatctcaaggaccctaaagtttgtaacatcagatatcgggaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 10 open reading frame 53 - chromosome 9 open reading frame 100 - chromosome 1 open reading frame 158 - chromosome 1 open reading frame 128 |