MRPS18C-mitochondrial ribosomal protein S18C Gene View larger

MRPS18C-mitochondrial ribosomal protein S18C Gene

PTXBC005186

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS18C-mitochondrial ribosomal protein S18C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS18C-mitochondrial ribosomal protein S18C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005186
Product type: DNA & cDNA
Ncbi symbol: MRPS18C
Origin species: Human
Product name: MRPS18C-mitochondrial ribosomal protein S18C Gene
Size: 2ug
Accessions: BC005186
Gene id: 51023
Gene description: mitochondrial ribosomal protein S18C
Synonyms: CGI-134; MRP-S18-1; MRP-S18-c; MRPS18-1; S18mt-c; mrps18-c; 28S ribosomal protein S18c, mitochondrial; 28S ribosomal protein S18-1, mitochondrial; mitochondrial ribosomal protein S18-1; mitochondrial ribosomal protein S18C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgctgtggttgctgtttgcggtggtctagggaggaagaagttgacacacttggtaacggctgctgtcagccttacacatcccgggactcacacggtgctttggagaagaggttgttcacaacaggtatccagcaatgaggacctgcccatttcaatggaaaatccttataaagaacctcttaagaaatgtatcttgtgtggaaagcatgtagattataagaatgtacagcttttgtcccagtttgtttctccatttactggatgcatttatggaaggcacattacaggtctttgtgggaagaaacagaaagaaatcacaaaagcaattaagagagctcaaataatggggtttatgccagttacatacaaggatcctgcatatctcaaggaccctaaagtttgtaacatcagatatcgggaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 10 open reading frame 53
- chromosome 9 open reading frame 100
- chromosome 1 open reading frame 158
- chromosome 1 open reading frame 128

Buy MRPS18C-mitochondrial ribosomal protein S18C Gene now

Add to cart