C1orf109-chromosome 1 open reading frame 109 Gene View larger

C1orf109-chromosome 1 open reading frame 109 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf109-chromosome 1 open reading frame 109 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf109-chromosome 1 open reading frame 109 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018109
Product type: DNA & cDNA
Ncbi symbol: C1orf109
Origin species: Human
Product name: C1orf109-chromosome 1 open reading frame 109 Gene
Size: 2ug
Accessions: BC018109
Gene id: 54955
Gene description: chromosome 1 open reading frame 109
Synonyms: uncharacterized protein C1orf109; chromosome 1 open reading frame 109
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactcaagaccggcctctgcttgccgtgcaggaggcgctgaagaagtgcttccccgtggtggaggagcagcagggcctgtggcagagtgccctgcgggactgccagcccctcctgtcctccctcagcaacctggcggaacagctgcaggccgcacagaacctgcggtttgaggatgtgccggcgcttcgggccttcccagatttaaaagagcggctgaggcagccatcctcctcaaggtgcgagacatggtcagcagccatgtggagcgagtgtttcagatctatgagcaacacgcagacacagttggcattgatgctgtcctgcagccttcagcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S18C
- chromosome 10 open reading frame 53
- chromosome 9 open reading frame 100
- chromosome 1 open reading frame 158

Buy C1orf109-chromosome 1 open reading frame 109 Gene now

Add to cart