C12orf53-chromosome 12 open reading frame 53 Gene View larger

C12orf53-chromosome 12 open reading frame 53 Gene

PTXBC035736

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf53-chromosome 12 open reading frame 53 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf53-chromosome 12 open reading frame 53 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035736
Product type: DNA & cDNA
Ncbi symbol: C12orf53
Origin species: Human
Product name: C12orf53-chromosome 12 open reading frame 53 Gene
Size: 2ug
Accessions: BC035736
Gene id: 196500
Gene description: chromosome 12 open reading frame 53
Synonyms: C12orf53; LEDA1; PANP; leda-1; PILR alpha-associated neural protein; PILR-associating neural protein; liver endothelial differentiation-associated protein-1; paired immunoglobin-like type 2 receptor-associating neural protein; PILR alpha associated neural protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtccaggatgtggcctgcgctgctgctgtcccacctcctccctctctggccactgctgttgctgcccctcccaccgcctgctcagggctcttcatcctcccctcgaaccccaccagccccagcccgccccccgtgtgccaggggaggcccctcggccccacgtcatgtgtgcgtgtgggagcgagcacctccaccaagccgatctcctcgggtcccaagatcacgtcggcaagtcctgcctggcactgcacccccagccaccccatcaggctttgaggaggggccgccctcatcccaatacccctgggctatcgtgtggggtcccaccgtgtctcgagaggatggaggggaccccaactctgccaatcccggatttctggactatggttttgcagcccctcatgggctcgcaaccccacaccccaactcagactccatgcgaggtgatggagatgggcttatccttggagaggcacctgccaccctgcggccattcctgttcgggggccgtggggaaggtgtggacccccagctctatgtcacaattaccatctccatcatcattgttctcgtggccactggcatcatcttcaagttctgctgggaccgcagccagaagcgacgcagaccctcagggcagcaaggtgccctgaggcaggaggagagccagcagccactgacagacctgtccccggctggagtcactgtgctgggggccttcggggactcacctacccccacccctgaccatgaggagccccgagggggaccccggcctgggatgccccaccccaagggggctccagccttccagttgaaccggattcccctggtgaatctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 19 open reading frame 53
- chromosome 16 open reading frame 14
- chromosome 17 open reading frame 61
- chromosome 1 open reading frame 109

Buy C12orf53-chromosome 12 open reading frame 53 Gene now

Add to cart