C1orf131-chromosome 1 open reading frame 131 Gene View larger

C1orf131-chromosome 1 open reading frame 131 Gene

PTXBC036800

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf131-chromosome 1 open reading frame 131 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf131-chromosome 1 open reading frame 131 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036800
Product type: DNA & cDNA
Ncbi symbol: C1orf131
Origin species: Human
Product name: C1orf131-chromosome 1 open reading frame 131 Gene
Size: 2ug
Accessions: BC036800
Gene id: 128061
Gene description: chromosome 1 open reading frame 131
Synonyms: uncharacterized protein C1orf131; chromosome 1 open reading frame 131
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgcaggagcaagggccggggtcctccacgcctcccagttctccgacacttcttgacgctctgctccagaacctttacgactttggaggtacagaaggtgaaacagaacagaagaagatcataaagaaaagggaaaacaagaagagagatgtgatggcttcagcggccttggcagcagagccatctcccctacctggttctctcataagaggccagaggaagagcgcttcgagcttcttcaaggaacttagagaagagcggcattgtgctccttctgggacccccacaggaccagagatccttgctgctgcagttcctccctcttccctaaagaacaatagggaacaagtagaagtggtagaatttcacagcaataaaaaaagaaaattgacgccagatcataacaagaacacaaaggctaatcctagtgttttggagagagatgtggatacacaagaatttaacctagaaaaagctcgtttagaagtgcaccggtttggtatcacgggttatggaaaaggaaaggagagaatcctggaacaggaacgtgccattatgctgggcgctaagcctcctaaaaagagttatgtgaattacaaggttttacaggagcaaattaaagaaaaaaaggcagcaaaggaagaagaaaagagactggcccaagaaacagatattttcaagaaaaagaagaggaaaggacaggaggacaggaaatccaaaaagaagtccgctcccagtattttgtcaaatggacggattggacaggttggaaaattcaaaaatggaacactgattctgagcccagttgatatcaagaaaataaattcttccagagtggccaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 12 open reading frame 53
- chromosome 19 open reading frame 53
- chromosome 16 open reading frame 14
- chromosome 17 open reading frame 61

Buy C1orf131-chromosome 1 open reading frame 131 Gene now

Add to cart