Login to display prices
Login to display prices
C18orf18-chromosome 18 open reading frame 18 Gene View larger

C18orf18-chromosome 18 open reading frame 18 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C18orf18-chromosome 18 open reading frame 18 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C18orf18-chromosome 18 open reading frame 18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010538
Product type: DNA & cDNA
Ncbi symbol: C18orf18
Origin species: Human
Product name: C18orf18-chromosome 18 open reading frame 18 Gene
Size: 2ug
Accessions: BC010538
Gene id: 147525
Gene description: chromosome 18 open reading frame 18
Synonyms: C18orf18; HsT959; long intergenic non-protein coding RNA 526
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctcatagctacaagaaggcaatttctgacgaagccctccgtcccttccaaatggattattttggcgggcttccacccggacagtatgccacccgaatgactggacaagtgcacgggagcggctgtcatttgcggagtgcgccttgcgatctaggcgcctcacagcgcaaattatccagtaatttctctgaaatcgatgctggtttgttttcccaaggcaaatcagcagcttatacagacattggggccacaaagccggtggaacaacgggagacggcttcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 131
- chromosome 12 open reading frame 53
- chromosome 19 open reading frame 53
- chromosome 16 open reading frame 14