C14orf79-chromosome 14 open reading frame 79 Gene View larger

C14orf79-chromosome 14 open reading frame 79 Gene

PTXBC011537

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf79-chromosome 14 open reading frame 79 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf79-chromosome 14 open reading frame 79 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011537
Product type: DNA & cDNA
Ncbi symbol: C14orf79
Origin species: Human
Product name: C14orf79-chromosome 14 open reading frame 79 Gene
Size: 2ug
Accessions: BC011537
Gene id: 122616
Gene description: chromosome 14 open reading frame 79
Synonyms: uncharacterized protein C14orf79; chromosome 14 open reading frame 79
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagattgtgacctcaaagagcctgaaggactcctcactgtcagcagcttctgtctccagcattgcaaagccctgatccagaccaagctctcggggccgcctggcagcaaacaggggaggctgatgacatgcagccgcttcctgaagaccccctcatgcggaggtggccagcacatcactattccaaggaaaaggatgttcactccacgcaagctcaaattgacactctttaatagcgacgtttgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 11 open reading frame 67
- chromosome 18 open reading frame 18
- chromosome 1 open reading frame 131
- chromosome 12 open reading frame 53

Buy C14orf79-chromosome 14 open reading frame 79 Gene now

Add to cart