Login to display prices
Login to display prices
XAGE1A-X antigen family, member 1A Gene View larger

XAGE1A-X antigen family, member 1A Gene

PTXBC009538

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of XAGE1A-X antigen family, member 1A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about XAGE1A-X antigen family, member 1A Gene

Proteogenix catalog: PTXBC009538
Ncbi symbol: XAGE1A
Product name: XAGE1A-X antigen family, member 1A Gene
Size: 2ug
Accessions: BC009538
Gene id: 653219
Gene description: X antigen family, member 1A
Synonyms: XAGE1A; CT12.1; CT12.1A; CT12.1B; CTP9; GAGED2; XAGE-1; XAGE1; X antigen family member 1; G antigen family D member 2; X antigen family, member 1A; cancer/testis antigen 12.1; cancer/testis antigen family 12, member 1a; cancer/testis antigen family 12, member 1b; cancer/testis associated protein; protein XAGE-1; X antigen family member 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagccccaaaaagaagaaccagcagctgaaagtcgggatcctacacctgggcagcagacagaagaagatcaggatacagctgagatcccagtgcgcgacatggaaggtgatctgcaagagctgcatcagtcaaacaccggggataaatctggatttgggttccggcgtcaaggtgaagataatacctaaagaggaacactgtaaaatgccagaagcaggtgaagagcaaccacaagtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: