Cart 15 Product Products 2 130,60 € (empty)
-
1 x NSMCE4A-no...121,50 € -
1 x PPIL3-pept...113,40 € -
-
1 x NMUR2-neur...121,50 € -
1 x SCAND2-SCA...113,40 € -
1 x MAGEC3-mel...121,50 € -
1 x SRP9-signa...113,40 € -
1 x NME4-non-m...113,40 € -
1 x SLC25A16-s...113,40 € -
1 x DOC2A-doub...121,50 € -
-
-
-
-
1 x LOC1001295...113,40 €
No products
To be determined Shipping
2 130,60 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 15 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 130,60 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 130,60 €
Data sheet of XAGE1A-X antigen family, member 1A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about XAGE1A-X antigen family, member 1A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009538 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | XAGE1A |
| Origin species: | Human |
| Product name: | XAGE1A-X antigen family, member 1A Gene |
| Size: | 2ug |
| Accessions: | BC009538 |
| Gene id: | 653219 |
| Gene description: | X antigen family, member 1A |
| Synonyms: | XAGE1A; CT12.1; CT12.1A; CT12.1B; CTP9; GAGED2; XAGE-1; XAGE1; X antigen family member 1; G antigen family D member 2; X antigen family, member 1A; cancer/testis antigen 12.1; cancer/testis antigen family 12, member 1a; cancer/testis antigen family 12, member 1b; cancer/testis associated protein; protein XAGE-1; X antigen family member 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagagccccaaaaagaagaaccagcagctgaaagtcgggatcctacacctgggcagcagacagaagaagatcaggatacagctgagatcccagtgcgcgacatggaaggtgatctgcaagagctgcatcagtcaaacaccggggataaatctggatttgggttccggcgtcaaggtgaagataatacctaaagaggaacactgtaaaatgccagaagcaggtgaagagcaaccacaagtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein, large, P1 - claudin domain containing 1 - snail homolog 1 (Drosophila) - integral membrane protein 2B |