FNDC3B-fibronectin type III domain containing 3B Gene View larger

FNDC3B-fibronectin type III domain containing 3B Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FNDC3B-fibronectin type III domain containing 3B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FNDC3B-fibronectin type III domain containing 3B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012204
Product type: DNA & cDNA
Ncbi symbol: FNDC3B
Origin species: Human
Product name: FNDC3B-fibronectin type III domain containing 3B Gene
Size: 2ug
Accessions: BC012204
Gene id: 64778
Gene description: fibronectin type III domain containing 3B
Synonyms: FAD104; PRO4979; YVTM2421; fibronectin type III domain-containing protein 3B; HCV NS5A-binding protein 37; factor for adipocyte differentiation 104; fibronectin type III domain containing 3B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgatgaccgaccaaatccctctggaactgccaccattgctgaacggagaggtagccatgatgccccacttggtgaatggagatgcagctcagcaggttattctcgttcaagttaatccaggtgagactttcacaataagagcagaggatggaacacttcagtgcattcaagatgaagtggtgaagagagcctgcgattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cysteine conjugate-beta lyase, cytoplasmic
- ATPase, H+/K+ exchanging, beta polypeptide
- transcription elongation factor A (SII), 2
- mitogen-activated protein kinase kinase 2

Buy FNDC3B-fibronectin type III domain containing 3B Gene now

Add to cart