Login to display prices
Login to display prices
ATP4B-ATPase, H+/K+ exchanging, beta polypeptide Gene View larger

ATP4B-ATPase, H+/K+ exchanging, beta polypeptide Gene

PTXBC029059

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP4B-ATPase, H+/K+ exchanging, beta polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP4B-ATPase, H+/K+ exchanging, beta polypeptide Gene

Proteogenix catalog: PTXBC029059
Ncbi symbol: ATP4B
Product name: ATP4B-ATPase, H+/K+ exchanging, beta polypeptide Gene
Size: 2ug
Accessions: BC029059
Gene id: 496
Gene description: ATPase, H+/K+ exchanging, beta polypeptide
Synonyms: ATP6B; potassium-transporting ATPase subunit beta; ATPase, H+/K+ exchanging, beta polypeptide; ATPase, H+/K+ transporting, beta polypeptide; gastric H(+)/K(+) ATPase subunit beta; gastric H+/K+ ATPase beta subunit; gastric hydrogen-potassium ATPase, beta; potassium-transporting ATPase beta chain; proton pump beta chain; ATPase H+/K+ transporting beta subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctctgcaggagaagaagacgtgtggccagcgcatggaggagttccagcgttactgctggaacccggacacggggcagatgctgggccgcaccctgtcccggtgggtgtggatcagcctgtactacgtggccttctacgtggtgatgactgggctcttcgccctgtgcctctatgtgctgatgcagacagtggacccgtacacaccggactaccaagaccagctacggtcaccaggggtaaccttaaggccggatgtttacggggagaaaggcctggaaattgtctacaacgtctctgataacagaacctgggcagacctcacacagactctccacgccttcctagcaggctactctccagcagcccaggaggacagcatcaactgcacctccgagcagtacttcttccaggagagtttccgcgctcccaaccacaccaagttctcctgcaagttcacggcagatatgctgcagaactgctcaggcctggcggatcccaacttcggctttgaagaaggaaagccatgttttattattaaaatgaacaggatcgtcaagttcctccccagcaacggctcggcccccagagtggactgcgccttcctggaccagccccgcgagctcggccagccgctgcaggtcaagtactaccctcccaacggcaccttcagtctgcactacttcccttattacgggaagaaagcccagccccactacagcaaccccctggtggcagcgaagctcctcaacatccccaggaacgctgaggtcgccatcgtgtgcaaggtcatggcagagcacgtgaccttcaacaatccccacgacccgtatgaagggaaagtggagttcaaactcaagattgagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: