Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ATP4B-ATPase, H+/K+ exchanging, beta polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP4B-ATPase, H+/K+ exchanging, beta polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029059 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP4B |
| Origin species: | Human |
| Product name: | ATP4B-ATPase, H+/K+ exchanging, beta polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC029059 |
| Gene id: | 496 |
| Gene description: | ATPase, H+/K+ exchanging, beta polypeptide |
| Synonyms: | ATP6B; potassium-transporting ATPase subunit beta; ATPase, H+/K+ exchanging, beta polypeptide; ATPase, H+/K+ transporting, beta polypeptide; gastric H(+)/K(+) ATPase subunit beta; gastric H+/K+ ATPase beta subunit; gastric hydrogen-potassium ATPase, beta; potassium-transporting ATPase beta chain; proton pump beta chain; ATPase H+/K+ transporting beta subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggctctgcaggagaagaagacgtgtggccagcgcatggaggagttccagcgttactgctggaacccggacacggggcagatgctgggccgcaccctgtcccggtgggtgtggatcagcctgtactacgtggccttctacgtggtgatgactgggctcttcgccctgtgcctctatgtgctgatgcagacagtggacccgtacacaccggactaccaagaccagctacggtcaccaggggtaaccttaaggccggatgtttacggggagaaaggcctggaaattgtctacaacgtctctgataacagaacctgggcagacctcacacagactctccacgccttcctagcaggctactctccagcagcccaggaggacagcatcaactgcacctccgagcagtacttcttccaggagagtttccgcgctcccaaccacaccaagttctcctgcaagttcacggcagatatgctgcagaactgctcaggcctggcggatcccaacttcggctttgaagaaggaaagccatgttttattattaaaatgaacaggatcgtcaagttcctccccagcaacggctcggcccccagagtggactgcgccttcctggaccagccccgcgagctcggccagccgctgcaggtcaagtactaccctcccaacggcaccttcagtctgcactacttcccttattacgggaagaaagcccagccccactacagcaaccccctggtggcagcgaagctcctcaacatccccaggaacgctgaggtcgccatcgtgtgcaaggtcatggcagagcacgtgaccttcaacaatccccacgacccgtatgaagggaaagtggagttcaaactcaagattgagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transcription elongation factor A (SII), 2 - mitogen-activated protein kinase kinase 2 - eukaryotic translation termination factor 1 - ubiquitin-like modifier activating enzyme 5 |