Login to display prices
Login to display prices
MAP2K2-mitogen-activated protein kinase kinase 2 Gene View larger

MAP2K2-mitogen-activated protein kinase kinase 2 Gene

PTXBC018645

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAP2K2-mitogen-activated protein kinase kinase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAP2K2-mitogen-activated protein kinase kinase 2 Gene

Proteogenix catalog: PTXBC018645
Ncbi symbol: MAP2K2
Product name: MAP2K2-mitogen-activated protein kinase kinase 2 Gene
Size: 2ug
Accessions: BC018645
Gene id: 5605
Gene description: mitogen-activated protein kinase kinase 2
Synonyms: CFC4; MAPKK2; MKK2; PRKMK2; dual specificity mitogen-activated protein kinase kinase 2; ERK activator kinase 2; MAP kinase kinase 2; MAPK/ERK kinase 2; mitogen-activated protein kinase kinase 2, p45; mitogen-activated protein kinase kinase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggcccggaggaagccggtgctgccggcgctcaccatcaaccctaccatcgccgagggcccatcccctaccagcgagggcgcctccgaggcaaacctggtggacctgcagaagaagctggaggagctggaacttgacgagcagcagaagaagcggctggaagcctttctcacccagaaagccaaggtcggcgaactcaaagacgatgacttcgaaaggatctcagagctgggcgcgggcaacggcggggtggtcaccaaagtccagcacagaccctcgggcctcatcatggccaggaagctgatccaccttgagatcaagccggccatccggaaccagatcatccgcgagctgcaggtcctgcacgaatgcaactcgccgtacatcgtgggcttctacggggccttctacagtgacggggagatcagcatttgcatggaacacatggatggcggctccctggaccaggtgctgaaagaggccaagaggattcccgaggagatcctggggaaagtcagcatcgcggttctccggggcttggcgtacctccgagagaagcaccagatcatgcaccgagatgtgaagccctccaacatcctcgtgaactctagaggggagatcaagctgtgtgacttcggggtgagcggccagctcatagactccatggccaactccttcgtgggcacgcgctcctacatggctccggagcggttgcagggcacacattactcggtgcagtcggacatctggagcatgggcctgtccctggtggagctggccgtcggaaggtaccccatccccccgcccgacgccaaagagctggaggccatctttggccggcccgtggtcgacggggaagaaggagagcctcacagcatctcgcctcggccgaggccccccgggcgccccgtcagcggtcacgggatggatagccggcctgccatggccatctttgaactcctggactatattgtgaacgagccacctcctaagctgcccaacggtgtgttcacccccgacttccaggagtttgtcaataaatgcctcatcaagaacccagcggagcgggcggacctgaagatgctcacaaaccacaccttcatcaagcggtccgaggtggaagaagtggattttgccggctggttgtgtaaaaccctgcggctgaaccagcccggcacacccacgcgcaccgccgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: