NOLC1-nucleolar and coiled-body phosphoprotein 1 Gene View larger

NOLC1-nucleolar and coiled-body phosphoprotein 1 Gene

PTXBC006769

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NOLC1-nucleolar and coiled-body phosphoprotein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NOLC1-nucleolar and coiled-body phosphoprotein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006769
Product type: DNA & cDNA
Ncbi symbol: NOLC1
Origin species: Human
Product name: NOLC1-nucleolar and coiled-body phosphoprotein 1 Gene
Size: 2ug
Accessions: BC006769
Gene id: 9221
Gene description: nucleolar and coiled-body phosphoprotein 1
Synonyms: NOPP130; NOPP140; NS5ATP13; P130; nucleolar and coiled-body phosphoprotein 1; 140 kDa nucleolar phosphoprotein; HCV NS5A trans-regulated protein 13; HCV NS5A-transactivated protein 13; hepatitis C virus NS5A-transactivated protein 13; nucleolar 130 kDa protein; nucleolar and coiled-body phosphprotein 1; nucleolar phosphoprotein p130; nucleolar protein p130
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaaataaaccaggtccctacagttcagtccccccgccttctgctcccccaccaaagaagtctctgggaacccagcctcccaagaaggctgtggagaagcagcagcctgtggaaagcagtgaagacagcagtgatgagtctgattcaagttctgaagaagagaagaaacccccaactaaggcagtagtctctaaagcaaccactaaaccacctccagcaaagaaagcagcagagagctcttcagacagctcagactctgacagctctgaggatgatgaagctccttctaagccagctggtaccaccaagaattcttcaaataagccagctgtcaccaccaagtcacctgcagtgaagccagctgcagcccccaagcaacctgtgggcggtggccagaagcttctgacgagaaaggctgacagcagctccagtgaggaagagagcagctccagtgaggaggagaagacaaagaagatggtggccaccactaagcccaaggcgactgccaaagcagctctatctctgcctgccaagcaggctcctcagggtagtagggacagcagctctgattcagacagctccagcagtgaggaggaggaagagaagacatctaagtctgcagttaagaagaagccacagaaggtagcaggaggtgcagccccttccaagccagcctctgcaaagaaaggaaaggctgagagcagcaacagttcttcttctgatgactccagtgaggaagaggaagagaagctcaagggcaagggctctccaagaccacaagcccccaaggccaatggcacctctgcactgactgcccagaatggaaaagcagctaagaacagtgaggaggaggaagaagaaaagaaaaaggcggcagtggtagtttccaaatcaggttcattaaagaagcggaagcagaatgaggctgccaaggaggcagagactcctcaggccaagaagataaagcttcagacccctaacacatttccaaaaaggaagaaaggagaaaaaagggcatcatccccattccgaagggtcagggaggaggaaattgaggtggattcacgagttgcggacaactcctttgatgccaagcgaggtgcagccggagactggggagagcgagccaatcaggttttgaagttcaccaaaggcaagtcctttcggcatgagaaaaccaagaagaagcggggcagctaccggggaggctcaatctctgtccaggtcaattctattaagtttgacagcgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 2',3'-cyclic nucleotide 3' phosphodiesterase
- 2',3'-cyclic nucleotide 3' phosphodiesterase
- ankyrin repeat and KH domain containing 1
- heterogeneous nuclear ribonucleoprotein K

Buy NOLC1-nucleolar and coiled-body phosphoprotein 1 Gene now

Add to cart