ANKHD1-ankyrin repeat and KH domain containing 1 Gene View larger

ANKHD1-ankyrin repeat and KH domain containing 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANKHD1-ankyrin repeat and KH domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ANKHD1-ankyrin repeat and KH domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004457
Product type: DNA & cDNA
Ncbi symbol: ANKHD1
Origin species: Human
Product name: ANKHD1-ankyrin repeat and KH domain containing 1 Gene
Size: 2ug
Accessions: BC004457
Gene id: 54882
Gene description: ankyrin repeat and KH domain containing 1
Synonyms: MASK; MASK1; PP2500; VBARP; ankyrin repeat and KH domain-containing protein 1; HIV-1 Vpr-binding ankyrin repeat protein; multiple ankyrin repeats, single KH-domain homolog; ankyrin repeat and KH domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagcagaaaacagccacaatgcaggacaagtggacactcgcagtctagcagaagcttgttcagatggggatgttaatgctgttcgtaaattgctagatgaaggcagaagtgtaaatgaacatacagaagaaggagaaagcctgctgtgtttggcttgttcagcagggtattatgaattagcacaagtattgcttgctatgcatgctaatgttgaagatcgagggaataaaggagacataactcccctgatggcagcttccagtggaggttacttagatattgtgaaattattacttcttcatgatgctgatgtcaactcccagtctgcaacaggaaacactgcgctaacttatgcatgtgctggaggatttgttgacattgttaaagtgctccttaatgaaggtgcaaatatagaagatcataatgaaaatggacatactcccttaatggaagcagccagtgcaggtcatgtggaagttgcaagagttcttttagatcatggtgcaggcatcaacactcattctaatgaattcaaagaaagtgctctaacacttgcttgctacaaaggccatttggatatggttcgctttctacttgaagctggtgcagatcaagagcacaaaacagatgagatgcacactgccttaatggaggcctgcatggatggacatgtagaggtggcacgtttgcttttggatagtggtgctcaagtgaacatgcctgcagattcatttgaatctccattgacgctagctgcctgtggaggacatgttgaattggcagctctacttattgaaaggggagcaaatcttgaagaagttaatgatgaaggatacactcccttgatggaagctgcccgggaaggacatgaagaaatggtggcactactcttagcacaaggagcaaatataaatgcccagacagaagaaactcaagaaactgctcttactttggcttgctgtggaggattttctgaagttgcagactttcttattaaggcaggggctgatatagaacttggctgctccacacctctgatggaggcatctcaggagggacacctggaattggttaaatatttgctggcttctggcgctaatgtgcatgctacaacagcaacaggagacacagccttaacctatgcttgtgaaaatggacatacggatgttgcagatgttttacttcaagcaggggctgatttagacaagcaggaggacatgaagactattttggagggcatagatccggccaagcatcaggtgagggtggcctttgatgcttgtaagctactacgtaaagaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heterogeneous nuclear ribonucleoprotein K
- DEAD (Asp-Glu-Ala-As) box polypeptide 19B
- zinc finger, CCCH-type with G patch domain
- CAP-GLY domain containing linker protein 3

Buy ANKHD1-ankyrin repeat and KH domain containing 1 Gene now

Add to cart