ZGPAT-zinc finger, CCCH-type with G patch domain Gene View larger

ZGPAT-zinc finger, CCCH-type with G patch domain Gene


New product

Data sheet of ZGPAT-zinc finger, CCCH-type with G patch domain Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZGPAT-zinc finger, CCCH-type with G patch domain Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019338
Product type: DNA & cDNA
Ncbi symbol: ZGPAT
Origin species: Human
Product name: ZGPAT-zinc finger, CCCH-type with G patch domain Gene
Size: 2ug
Accessions: BC019338
Gene id: 84619
Gene description: zinc finger, CCCH-type with G patch domain
Synonyms: GPATC6; GPATCH6; KIAA1847; ZC3H9; ZC3HDC9; ZIP; zinc finger CCCH-type with G patch domain-containing protein; g patch domain-containing protein 6; zinc finger CCCH domain-containing protein 9; zinc finger and G patch domain-containing protein; zinc finger, CCCH-type with G patch domain; zinc finger CCCH-type and G-patch domain containing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgaggagagcctggagtcggccttgcagacctaccgtgcgcagctgcagcaggtggagctggccttgggcgccggcctggattcgtctgagcaggctgacctgcgccagctgcagggggacctgaaggagctcatcgagctcaccgaggccagcctggtgtctgtcaggaagagcagcttgttggccgcgctggacgaagagcgcccgggccgccaggaagatgctgagtaccaggctttccgggaggccatcactgaggcggtggaggcaccagcagcggcccgtgggtccggatcagagaccgttcctaaagcagaggcggggccagaatctgcggcaggtgggcaggaggaggaagagggagaggacgaggaagagctgagtgggacaaaggtgagcgcgccctactacagctcctggggcactctggagtatcacaacgccatggtggtgggaacggaagaggcggaggatggctcggcgggtgtccgtgtgctttacctgtaccccactcacaagtctctgaagccgtgcccgttcttcctggagggaaagtgccgctttaaggagaactgcaggttctcccatgggcaggtggtctctctggatgagctgcgccccttccaggacccagacctgagctccctgcaggccggctctgcgtgtctggccaagcaccaggatggcctctggcacgcagcacgcatcaccgatgtggacaacggctactacacagtcaagtttgactcgctgctgctgagggaggccgtggtggagggggacggcatcctgcccccactgcgcacagaggccacagagtccgactcagacagcgacgtggtggggtcagatgctgtggactctgggacctgcagctctgcctttgctggctgggaggtgcacacgcgaggtataggctccagactcctcaccaagatgggctatgagtttggcaagggtttgggccgacacgcggaaggccgggtggagcccatccatgctgtggtgttgcctcgagggaagtcgctggaccagtgtgtggagaccctgcagaagcagaccagggttggcaaggctggcaccaacaagccccccaggtgccggggaagaggggccaggcctgggggccgcccagctcctcggaatgtgtttgacttcctcaatgaaaagctgcaaggtcaggctcctggggccctagaagccagggcggccccagcggggaggaggagcaaggacatgtaccatgccagcaagagtgccaagcgggccctgagcctgcggctcttccagactgaggagaagatcgagcgaacccagcgggacatcaggagcatccaggaggctctcgcccgcaacgctggccggcatagcgtggcgtcagcccagctgcaggagaagctggcaggagcccagcgccagctggggcagctccgggctcaggaagccggcctgcagcaggagcagaggaaggcagacacccacaagaagatgactgagttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CAP-GLY domain containing linker protein 3
- heterogeneous nuclear ribonucleoprotein M
- low density lipoprotein-related protein 12
- BCL2-interacting killer (apoptosis-inducing)

Buy ZGPAT-zinc finger, CCCH-type with G patch domain Gene now

Add to cart