Login to display prices
Login to display prices
CNP-2',3'-cyclic nucleotide 3' phosphodiesterase Gene View larger

CNP-2',3'-cyclic nucleotide 3' phosphodiesterase Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CNP-2',3'-cyclic nucleotide 3' phosphodiesterase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CNP-2',3'-cyclic nucleotide 3' phosphodiesterase Gene

Proteogenix catalog: PTXBC006392
Ncbi symbol: CNP
Product name: CNP-2',3'-cyclic nucleotide 3' phosphodiesterase Gene
Size: 2ug
Accessions: BC006392
Gene id: 1267
Gene description: 2',3'-cyclic nucleotide 3' phosphodiesterase
Synonyms: CNP1; 2',3'-cyclic-nucleotide 3'-phosphodiesterase; 2', 3' cyclic nucleotide 3' phosphohydrolase; CNPase; 2',3'-cyclic nucleotide 3' phosphodiesterase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacagaggcttctcccgaaaaagccacacattcctgcccaagatcttcttccgcaagatgtcatcctcaggggccaaggacaagcctgagctgcagtttcccttccttcaggatgaggacacagtggccacgctgctagagtgcaagacgctcttcatcttgcgcggcctgccaggaagcggcaagtccacgctggcacgggtcatcgtggacaagtaccgtgatggcaccaagatggtgtcggctgacgcttacaagatcacccccggcgctcgaggagccttctccgaggagtacaagcggctcgatgaggacctggctgcctactgccgccgccgggacatcagaattcttgtgcttgatgacaccaaccacgaacgggaacggctggagcagctctttgaaatggccgaccagtaccagtaccaggtggtgctggtggagcccaagacggcgtggcggctggactgtgcccagctcaaggagaagaaccagtggcagctgtcggctgatgacctgaagaagctgaagcctgggctggagaaggacttcctgccgctctacttcggctggttcctgaccaagaagagctctgagaccctccgcaaagccggccaggtcttcctggaagagctggggaaccacaaggccttcaagaaggagctgcgacaattcgtccctggggatgagcccagggagaagatggacttggtcacctactttggaaagagacccccaggcgtgctgcattgcacaaccaagttttgtgactacgggaaggctcccggggcagaggagtacgctcaacaagatgtgttaaagaaatcttactccaaggccttcacgctgaccatctctgccctctttgtgacacccaagacgactggggcccgggtggagttaagcgagcagcaactgcagttgtggccgagtgatgtggacaagctgtcacccactgacaacctgccgcgggggagccgcgcccacatcaccctcggctgtgcagctgacgtagaggccgtgcagacgggccttgacctcttagagattctgcggcaggagaaggggggcagccgaggcgaggaggtgggcgagctaagccggggcaagctctattccttgggcaatgggcgctggatgctgaccctggccaagaacatggaggtcagggccatcttcacgggatactacgggaaaggcaaacctgtgcccacgcaaggtagccggaaggggggcgccttgcagtcctgcaccatcatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: