TCEA2-transcription elongation factor A (SII), 2 Gene View larger

TCEA2-transcription elongation factor A (SII), 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TCEA2-transcription elongation factor A (SII), 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TCEA2-transcription elongation factor A (SII), 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018896
Product type: DNA & cDNA
Ncbi symbol: TCEA2
Origin species: Human
Product name: TCEA2-transcription elongation factor A (SII), 2 Gene
Size: 2ug
Accessions: BC018896
Gene id: 6919
Gene description: transcription elongation factor A (SII), 2
Synonyms: TFIIS; transcription elongation factor A protein 2; testis-specific S-II; transcription elongation factor A (SII), 2; transcription elongation factor S-II protein 2; transcription elongation factor TFIIS.1; transcription elongation factor TFIIS.l; transcription elongation factor A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgggcaaggaagaggagattgcgcggatcgcccggaggctggacaagatggtgaccaagaagagcgcggagggagccatggatttgctgcgggagctgaaggccatgcctatcacgctgcacctgctccagtccacccgagtcgggatgtctgtcaacgcccttcggaagcagagctcggatgaggaggtcattgcactggccaagtctctcatcaagtcctggaagaagctcctggatgcttccgatgccaaagccagggagcgggggaggggcatgcctctgcccacgtcctcgagggatgcctcagaggccccggatcccagccgcaagaggccggagctgcccagggcaccgtcgactccgaggatcaccacatttcctccggtgcctgtcacctgtgatgccgtgcgcaacaagtgccgcgagatgctgaccgctgccctgcagacggaccatgaccacgtggccatcggtgcggactgcgagcgcctgtcggctcagatcgaggaatgcatcttccgggacgttggaaacacagacatgaagtataagaaccgtgtacggagtcgtatctccaacctgaaggatgccaagaaccctgacctgcggcggaatgtgctgtgtggggccataacaccccagcagatcgctgtgatgacctcagaggagatggccagtgatgagctgaaggagatccgtaaggccatgaccaaggaggccatccgagagcaccagatggcccgcactggcggcacgcagacagacctgttcacctgcggcaagtgcaggaaaaagaactgcacctacacacaggtgcagacccgcagctctgatgagcccatgaccacctttgttgtctgcaacgagtgtggaaaccgctggaagttctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitogen-activated protein kinase kinase 2
- eukaryotic translation termination factor 1
- ubiquitin-like modifier activating enzyme 5
- nucleolar and coiled-body phosphoprotein 1

Buy TCEA2-transcription elongation factor A (SII), 2 Gene now

Add to cart