MAPK15-mitogen-activated protein kinase 15 Gene View larger

MAPK15-mitogen-activated protein kinase 15 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPK15-mitogen-activated protein kinase 15 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAPK15-mitogen-activated protein kinase 15 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028034
Product type: DNA & cDNA
Ncbi symbol: MAPK15
Origin species: Human
Product name: MAPK15-mitogen-activated protein kinase 15 Gene
Size: 2ug
Accessions: BC028034
Gene id: 225689
Gene description: mitogen-activated protein kinase 15
Synonyms: ERK7; mitogen-activated protein kinase 15; ERK-7; ERK-8; MAP kinase 15; MAPK 15; extracellular regulated kinase 8 delta; extracellular signal-regulated kinase 7; extracellular signal-regulated kinase 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcaccgtagtggaccctcgcattgtccggagatacctactcaggcggcagctcgggcagggggcctatggcattgtgtggaaggcagtggaccggaggactggtgaggtcgtggccatcaagaaaatctttgatgcttttagggataagacagatgcccagagaacattccgggaaatcacgctcctccaggagtttggggaccatcccaacatcatcagcctccttgacgtgatccgggcagagaacgacagggacatttacctggtgtttgagtttatgggttgcccccccagccccccacccccgactgcagtgcgcaccctctctgcagacactgacctgaacgcagtcatccggaagggcggcctgctgcaggacgtccacgtgcgctccatcttctaccagctcctgcgggccacccggttcctccactcggggcacgttgtgcaccgggaccagaagccgtccaatgtgctcctggatgccaactgcacagtgaagctgtgtgactttggcctggcccgctccctgggcgacctccctgaggggcctgaggaccaggccgtgacagagtacgtggccacacgctggtaccgagcaccggaggtgctgctctcttcgcaccgatacacccttggggtggacatgtggagtctgggctgtatcctgggggagatgctgcgggggagacccctgttccccggcacgtccaccctccaccagctggagctgatcctggagaccatcccaccgccatctgaggaggacctcctggctctcggctcaggctgccgtgcctctgtgctgcaccagctggggtcccggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 80
- mitochondrial ribosomal protein S33
- alpha-2-glycoprotein 1, zinc-binding
- chromosome 2 open reading frame 58

Buy MAPK15-mitogen-activated protein kinase 15 Gene now

Add to cart