Login to display prices
Login to display prices
MAPK15-mitogen-activated protein kinase 15 Gene View larger

MAPK15-mitogen-activated protein kinase 15 Gene

PTXBC028034

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPK15-mitogen-activated protein kinase 15 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAPK15-mitogen-activated protein kinase 15 Gene

Proteogenix catalog: PTXBC028034
Ncbi symbol: MAPK15
Product name: MAPK15-mitogen-activated protein kinase 15 Gene
Size: 2ug
Accessions: BC028034
Gene id: 225689
Gene description: mitogen-activated protein kinase 15
Synonyms: ERK7; mitogen-activated protein kinase 15; ERK-7; ERK-8; MAP kinase 15; MAPK 15; extracellular regulated kinase 8 delta; extracellular signal-regulated kinase 7; extracellular signal-regulated kinase 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcaccgtagtggaccctcgcattgtccggagatacctactcaggcggcagctcgggcagggggcctatggcattgtgtggaaggcagtggaccggaggactggtgaggtcgtggccatcaagaaaatctttgatgcttttagggataagacagatgcccagagaacattccgggaaatcacgctcctccaggagtttggggaccatcccaacatcatcagcctccttgacgtgatccgggcagagaacgacagggacatttacctggtgtttgagtttatgggttgcccccccagccccccacccccgactgcagtgcgcaccctctctgcagacactgacctgaacgcagtcatccggaagggcggcctgctgcaggacgtccacgtgcgctccatcttctaccagctcctgcgggccacccggttcctccactcggggcacgttgtgcaccgggaccagaagccgtccaatgtgctcctggatgccaactgcacagtgaagctgtgtgactttggcctggcccgctccctgggcgacctccctgaggggcctgaggaccaggccgtgacagagtacgtggccacacgctggtaccgagcaccggaggtgctgctctcttcgcaccgatacacccttggggtggacatgtggagtctgggctgtatcctgggggagatgctgcgggggagacccctgttccccggcacgtccaccctccaccagctggagctgatcctggagaccatcccaccgccatctgaggaggacctcctggctctcggctcaggctgccgtgcctctgtgctgcaccagctggggtcccggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: