C16orf74-chromosome 16 open reading frame 74 Gene View larger

C16orf74-chromosome 16 open reading frame 74 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf74-chromosome 16 open reading frame 74 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf74-chromosome 16 open reading frame 74 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009078
Product type: DNA & cDNA
Ncbi symbol: C16orf74
Origin species: Human
Product name: C16orf74-chromosome 16 open reading frame 74 Gene
Size: 2ug
Accessions: BC009078
Gene id: 404550
Gene description: chromosome 16 open reading frame 74
Synonyms: uncharacterized protein C16orf74; chromosome 16 open reading frame 74
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtgtcagcagcagcagcagcagccacgacgaggcccccgtcctgaacgacaagcacctggacgtgcccgacatcatcatcacgccccccacccccacgggcatgatgctgccgagggacttggggagcacagtctggctggatgagacagggtcgtgcccagatgatggagaaatcgacccagaagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 79
- chromosome 11 open reading frame 67
- chromosome 18 open reading frame 18
- chromosome 1 open reading frame 131

Buy C16orf74-chromosome 16 open reading frame 74 Gene now

Add to cart