Login to display prices
Login to display prices
IWS1-IWS1 homolog (S. cerevisiae) Gene View larger

IWS1-IWS1 homolog (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IWS1-IWS1 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IWS1-IWS1 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC017012
Ncbi symbol: IWS1
Product name: IWS1-IWS1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC017012
Gene id: 55677
Gene description: IWS1 homolog (S. cerevisiae)
Synonyms: IWS1, SUPT6H interacting protein; IWS1-like protein; IWS1 homolog; protein IWS1 homolog; interacts with Spt6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagagaaggatctgtttgggagtgacagtgagtcaggcaatgaagaagaaaatcttattgcagacatatttggagaatctggtgatgaagaggaagaagaatttacaggttttaaccaagaagatctggaagaagaaaaaggtgaaacacaggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: