IWS1-IWS1 homolog (S. cerevisiae) Gene View larger

IWS1-IWS1 homolog (S. cerevisiae) Gene

PTXBC017012

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IWS1-IWS1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IWS1-IWS1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017012
Product type: DNA & cDNA
Ncbi symbol: IWS1
Origin species: Human
Product name: IWS1-IWS1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC017012
Gene id: 55677
Gene description: IWS1 homolog (S. cerevisiae)
Synonyms: IWS1, SUPT6H interacting protein; IWS1-like protein; IWS1 homolog; protein IWS1 homolog; interacts with Spt6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagagaaggatctgtttgggagtgacagtgagtcaggcaatgaagaagaaaatcttattgcagacatatttggagaatctggtgatgaagaggaagaagaatttacaggttttaaccaagaagatctggaagaagaaaaaggtgaaacacaggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase inhibitory factor 1
- EGF-like-domain, multiple 8
- histone cluster 1, H2am
- Norrie disease (pseudoglioma)

Buy IWS1-IWS1 homolog (S. cerevisiae) Gene now

Add to cart