GATA3-GATA binding protein 3 Gene View larger

GATA3-GATA binding protein 3 Gene

PTXBC006839

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GATA3-GATA binding protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GATA3-GATA binding protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006839
Product type: DNA & cDNA
Ncbi symbol: GATA3
Origin species: Human
Product name: GATA3-GATA binding protein 3 Gene
Size: 2ug
Accessions: BC006839
Gene id: 2625
Gene description: GATA binding protein 3
Synonyms: HDR; HDRS; GATA-binding factor 3; GATA binding protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggatgccaagaagtttaaggaatatgggagaaatagtgtggaaattaagaagaaactaggtctgatattcaaatggacaaactgccagttttgtttcctttcactggccacagttgtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - brain protein 44-like
- spermatid maturation 1
- Bardet-Biedl syndrome 9
- catenin, beta like 1

Reviews

Buy GATA3-GATA binding protein 3 Gene now

Add to cart