ZCCHC9-zinc finger, CCHC domain containing 9 Gene View larger

ZCCHC9-zinc finger, CCHC domain containing 9 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZCCHC9-zinc finger, CCHC domain containing 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZCCHC9-zinc finger, CCHC domain containing 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032736
Product type: DNA & cDNA
Ncbi symbol: ZCCHC9
Origin species: Human
Product name: ZCCHC9-zinc finger, CCHC domain containing 9 Gene
Size: 2ug
Accessions: BC032736
Gene id: 84240
Gene description: zinc finger, CCHC domain containing 9
Synonyms: PPP1R41; protein phosphatase 1, regulatory subunit 41; zinc finger, CCHC domain containing 9; zinc finger CCHC-type containing 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccaggtgggcccgagttagtaccacatataacaagagagccttgcctgcaacatcatgggaggacatgaagaagggatcctttgagggaacaagccaaaacctaccaaagcgtaaacaacttgaagccaataggctatccctcaaaaatgatgcaccccaagcaaaacataaaaagaacaaaaagaaaaaagagtacttaaatgaagatgtgaatggattcatggaatacctaagacagaattcacagatggttcacaatgggcaaattatagcaacagacagtgaggaagtaagggaagaaattgcagttgctttaaagaaagacagtcgacgggaaggaagaagattaaaaagacaagcggcaaagaaaaatgcaatggtgtgtttccattgtagaaaacctggtcatggaattgcagattgccccgctgcccttgaaaatcaagacatgggcactgggatatgttacaggtgtgggtccacagagcacgaaataaccaagtgtaaggctaaagtagacccggctcttggcgaatttccttttgcaaaatgttttgtttgtggagaaatggggcacctgtctagatcttgtcctgataatcccaaaggactctatgctgatggtggcggttgcaaactttgtggctctgtggaacatttaaagaaagattgccctgaaagtcagaattcagagcgaatggtcacagttggtcgctgggcaaagggaatgagtgcagactatgaagaaattttggatgtacctaaaccgcaaaaacccaaaacaaaaatacctaaagttgttaatttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 16 open reading frame 74
- chromosome 14 open reading frame 79
- chromosome 11 open reading frame 67
- chromosome 18 open reading frame 18

Buy ZCCHC9-zinc finger, CCHC domain containing 9 Gene now

Add to cart