Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC25A21-solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 Gene
PTXBC113365
New product
Data sheet of SLC25A21-solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A21-solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113365 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A21 |
| Origin species: | Human |
| Product name: | SLC25A21-solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 Gene |
| Size: | 2ug |
| Accessions: | BC113365 |
| Gene id: | 89874 |
| Gene description: | solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 |
| Synonyms: | ODC; ODC1; mitochondrial 2-oxodicarboxylate carrier; solute carrier family 25 (mitochondrial oxoadipate carrier), member 21; solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21; solute carrier family 25 member 21 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgccaagcctgaagtcagcttagtgcgcgaggcttctcggcagatcgtggccggtggttctgcaggtcttgtagaaatttgcctgatgcaccccctagatgtggtgaaaaccaggtttcagattcagagatgtgcaaccgatccaaacagttataaaagcttggtagacagctttcgaatgattttccaaatggaagggttatttggtttttacaagggaattctgccacctatcttggctgaaaccccaaaaagagcagtgaagtttttcacctttgagcagtacaagaaattgctgggatatgtgtcactgtcaccagcattgacattcgccattgctggattgggatctggactaacagaagccattgtagttaacccttttgaggtagtaaaagttggcttgcaagcaaatcggaacacatttgcagagcaaccatccactgtgggttatgcaagacaaatcattaagaaggaaggctggggactccagggcctcaacaaaggattaactgcaactttgggacgacatggagttttcaacatggtttattttggcttctactacaatgtcaaaaacatgattcctgtcaataaggatccaatcttggagttttggagaaaatttgggattggtcttctctcggggacaatagcctcagtcattaacatcccttttgatgttgccaaaagtaggattcaagggcctcaaccagttcctggagagatcaagtacagaacctgttttaaaacaatggcaacagtctatcaggaagaagggattttagctttgtacaaaggcctgcttcccaagattatgagacttggaccaggtggtgcagtgatgctgctggtttatgaatacacctattcatggcttcaagagaactggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylinositol-5-phosphate 4-kinase, type II, beta - signal peptidase complex subunit 1 homolog (S. cerevisiae) - protein phosphatase 1, regulatory (inhibitor) subunit 1B - solute carrier family 26 (sulfate transporter), member 1 |