Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UBE2J2-ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast) Gene
PTXBC113430
New product
Data sheet of UBE2J2-ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2J2-ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113430 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2J2 |
| Origin species: | Human |
| Product name: | UBE2J2-ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast) Gene |
| Size: | 2ug |
| Accessions: | BC113430 |
| Gene id: | 118424 |
| Gene description: | ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast) |
| Synonyms: | NCUBE-2; NCUBE2; PRO2121; ubiquitin-conjugating enzyme E2 J2; E2 ubiquitin-conjugating enzyme J2; non-canonical ubiquitin-conjugating enzyme 2; ubiquitin conjugating enzyme 6; ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast); yeast UBC6 homolog; ubiquitin conjugating enzyme E2 J2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcagcaccagcagtaagagggctccgaccacggcaacccagaggctgaagcaggactaccttcgcattaagaaagacccggtgccttacatctgtgccgagcccctcccttcgaatattctcgagtggcactatgtcgtccgaggcccagagatgaccccttatgaaggtggctattatcatggaaaactaatttttcccagagaatttcctttcaaacctcccagtatctatatgatcactcccaacgggaggtttaagtgcaacaccaggctgtgtctttctatcacggatttccacccggacacgtggaacccggcctggtctgtctccaccatcctgactgggctcctgagcttcatggtggagaagggccccaccctgggcagtatagagacgtcggacttcacgaaaagacaactggcagtgcagagtttagcatttaatttgaaagataaagtcttttgtgaattatttcctgaagtcgtggaggagattaaacaaaaacagaaagcacaagacgaactcagtagcagaccccagactctccccttgccagacgtggttccagacggggagacgcaccttgtccagaacgggattcagctgctcaacgggcatgcgccgggggccgtcccaaacctcgcagggctccagcaggccaaccggcaccacggactcctgggtggcgccctggcgaacttgtttgtgatagttgggtttgcagcctttgcttacacggtcaagtacgtgctgaggagcatcgcgcaggagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signaling lymphocytic activation molecule family member 1 - tigger transposable element derived 5 - Ras homolog enriched in brain like 1 - GAR1 ribonucleoprotein homolog (yeast) |