Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
COX7A2-cytochrome c oxidase subunit VIIa polypeptide 2 (liver) Gene
PTXBC133654
New product
Data sheet of COX7A2-cytochrome c oxidase subunit VIIa polypeptide 2 (liver) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COX7A2-cytochrome c oxidase subunit VIIa polypeptide 2 (liver) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC133654 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX7A2 |
| Origin species: | Human |
| Product name: | COX7A2-cytochrome c oxidase subunit VIIa polypeptide 2 (liver) Gene |
| Size: | 2ug |
| Accessions: | BC133654 |
| Gene id: | 1347 |
| Gene description: | cytochrome c oxidase subunit VIIa polypeptide 2 (liver) |
| Synonyms: | COX7AL; COX7AL1; COXVIIAL; COXVIIa-L; VIIAL; cytochrome c oxidase subunit 7A2, mitochondrial; cytochrome c oxidase polypeptide 7A2, mitochondrial; cytochrome c oxidase polypeptide VIIa-liver/heart; cytochrome c oxidase subunit VIIa polypeptide 2 (liver); cytochrome c oxidase subunit VIIa-L; cytochrome c oxidase subunit VIIa-liver/heart; cytochrome c oxidase subunit VIIaL; hepatic cytochrome-c oxidase chain VIIa; cytochrome c oxidase subunit 7A2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgtggaatctgctggctcttcgtcagattgggcagaggacgataagcactgcttcccgcaggcattttaaaaataaagttccggagaagcaaaaactgttccaggaggatgatgaaattccactgtatctaaagggtggggtagctgatgccctcctgtatagagccaccatgattcttacagttggtggaacagcatatgccatatatgagctggctgtggcttcatttcccaagaagcaggagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor necrosis factor receptor superfamily, member 25 - fatty acid binding protein 1, liver - ubiquitin-conjugating enzyme E2L 6 - RAS (RAD and GEM)-like GTP binding 2 |