Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFRSF25-tumor necrosis factor receptor superfamily, member 25 Gene
PTXBC117189
New product
Data sheet of TNFRSF25-tumor necrosis factor receptor superfamily, member 25 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFRSF25-tumor necrosis factor receptor superfamily, member 25 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117189 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFRSF25 |
| Origin species: | Human |
| Product name: | TNFRSF25-tumor necrosis factor receptor superfamily, member 25 Gene |
| Size: | 2ug |
| Accessions: | BC117189 |
| Gene id: | 8718 |
| Gene description: | tumor necrosis factor receptor superfamily, member 25 |
| Synonyms: | APO-3; DDR3; DR3; LARD; TNFRSF12; TR3; TRAMP; WSL-1; WSL-LR; tumor necrosis factor receptor superfamily member 25; apoptosis inducing receptor; apoptosis-inducing receptor AIR; apoptosis-mediating receptor DR3; apoptosis-mediating receptor TRAMP; death domain receptor 3 soluble form; death receptor beta; lymphocyte-associated receptor of death; protein WSL-1; tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein); TNF receptor superfamily member 25 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcagcggccgcggggctgcgcggcggtggcggcggcgctcctcctggtgctgctgggggcccgggcccagggcggcactcgtagccccaggtgtgactgtgccggtgacttccacaagaagattggtctgttttgttgcagaggctgcccagcggggcactacctgaaggccccttgcacggagccctgcggcaactccacctgccttgtgtgtccccaagacaccttcttggcctgggagaaccaccataattctgaatgtgcccgctgccaggcctgtgatgagcaggcctcccaggtggcgctggagaactgttcagcagtggccgacacccgctgtggctgtaagccaggctggtttgtggagtgccaggtcagccaatgtgtcagcagttcacccttctactgccaaccatgcctagactgcggggccctgcaccgccacacacggctactctgttcccgcagagatactgactgtgggacctgcctgcctggcttctatgaacatggcgatggctgcgtgtcctgccccacgagcaccctggggagctgtccagagcgctgtgccgctgtctgtggctggaggcagatgttctgggtccaggtgctcctggctggccttgtggtccccctcctgcttggggccaccctgacctacacataccgccactgctggcctcacaagcccctggttactgcagatgaagctgggatggaggctctgaccccaccaccggccacccatctgtcacccttggacagcgcccacacccttctagcacctcctgacagcagtgagaagatctgcaccgtccagttggtgggtaacagctggacccctggctaccccgagacccaggaggcgctctgcccgcaggtgacatggtcctgggaccagttgcccagcagagctcttggccccgctgctgcgcccacactctcgccagagtccccagccggctcgccagccatgatgctgcagccgggcccgcagctctacgacgtgatggacgcggtcccagcgcggcgctggaaggagttcgtgcgcacgctggggctgcgcgaggcagagatcgaagccgtggaggtggagatcggccgcttccgagaccagcagtacgagatgctcaagcgctggcgccagcagcagcccgcgggcctcggagccgtttacgcggccctggagcgcatggggctggacggctgcgtggaagacttgcgcagccgcctgcagcgcggcccgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |