Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TAF13-TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa Gene
PTXBC121180
New product
Data sheet of TAF13-TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TAF13-TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121180 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TAF13 |
| Origin species: | Human |
| Product name: | TAF13-TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa Gene |
| Size: | 2ug |
| Accessions: | BC121180 |
| Gene id: | 6884 |
| Gene description: | TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa |
| Synonyms: | TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa; TAF(II)18; TAF2K; TAFII-18; TAFII18; transcription initiation factor TFIID subunit 13; TATA box binding protein (TBP)-associated factor, RNA polymerase II, K, 18kD; transcription initiation factor TFIID 18 kD subunit; transcription initiation factor TFIID 18 kDa subunit; TATA-box binding protein associated factor 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagatgaggaagaagaccccacgtttgaggaagaaaatgaagaaattggaggaggtgcagaaggtggacagggtaaaagaaagagacttttttctaaagaattgcgatgtatgatgtatggctttggggatgaccagaatccttatactgagtcagtggatattcttgaagatcttgtcatagagtttatcactgaaatgactcacaaggcaatgtcaattggaagacaaggtcgagtacaagttgaagatatcgtcttcttgattcgaaaggacccaaggaagtttgccagggttaaagacttgcttactatgaatgaagaattgaaacgagctagaaaagcatttgatgaagcaaattatggatcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa - megalencephalic leukoencephalopathy with subcortical cysts 1 - small nuclear RNA activating complex, polypeptide 3, 50kDa - EGF-containing fibulin-like extracellular matrix protein 2 |