Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPSB3-splA/ryanodine receptor domain and SOCS box containing 3 Gene
PTXBC041897
New product
Data sheet of SPSB3-splA/ryanodine receptor domain and SOCS box containing 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPSB3-splA/ryanodine receptor domain and SOCS box containing 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC041897 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPSB3 |
| Origin species: | Human |
| Product name: | SPSB3-splA/ryanodine receptor domain and SOCS box containing 3 Gene |
| Size: | 2ug |
| Accessions: | BC041897 |
| Gene id: | 90864 |
| Gene description: | splA/ryanodine receptor domain and SOCS box containing 3 |
| Synonyms: | C16orf31; SSB3; SPRY domain-containing SOCS box protein 3; SPRY domain-containing SOCS box protein SSB-3; splA/ryanodine receptor domain and SOCS box containing 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtacagctgcggcacagcggccatccggggcaccaaggagctgggggagggccagcacttctgggagatcaagatgacctctcccgtctacggcaccgacatgatggtgggcatcgggacgtcggatgtggacctggacaaataccgccacacgttctgcagcctgctgggcagggatgaggacagctggggcctctcctacacgggcctcctccaccacaagggcgacaagaccagcttctcgtcgcggttcggccagggctccatcattggcgtgcacctggacacctggcacggcacactcacctttttcaagaacaggaagtgtataggtgtggcagccaccaagctgcagaacaagagattctacccgatggtgtgctccacggcggcccggagcagcatgaaggtcacccgctcctgtgccagcgccacttccctccagtacctgtgctgccaccgcctgcgccagctgcggccagactcgggagacacgctggagggtctgccgctgccgccgggcctcaagcaggtgctacacaacaagctgggctgggtcctgagcatgagttgcagccgccgcaaggctccagtgtccgatccccaggcagcgacctccgcccaccccagcagtcgcgagcctcggccctgccagaggaagcgctgccgccggacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 21, subfamily A, polypeptide 2 - cytochrome c oxidase subunit VIIa polypeptide 2 (liver) - tumor necrosis factor receptor superfamily, member 25 - fatty acid binding protein 1, liver |