PTXBC139900
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC139900 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ADAMTS12 |
| Origin species: | Human |
| Product name: | ADAMTS12-ADAM metallopeptidase with thrombospondin type 1 motif, 12 Gene |
| Size: | 2ug |
| Accessions: | BC139900 |
| Gene id: | 81792 |
| Gene description: | ADAM metallopeptidase with thrombospondin type 1 motif, 12 |
| Synonyms: | PRO4389; A disintegrin and metalloproteinase with thrombospondin motifs 12; ADAM-TS 12; ADAM-TS12; ADAMTS-12; a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12; ADAM metallopeptidase with thrombospondin type 1 motif 12 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccatgtgcccagaggagctggcttgcaaacctttccgtggtggctcagctccttaactttggggcgctttgctatgggagacagcctcagccaggcccggttcgcttcccggacaggaggcaagagcattttatcaagggcctgccagaataccacgtggtgggtccagtccgagtagatgccagtgggcattttttgtcatatggcttgcactatcccatcacgagcagcaggaggaagagagatttggatggctcagaggactgggtgtactacagaatttctcacgaggagaaggacctgttttttaacttgacggtcaatcaaggatttctttccaatagctacatcatggagaagagatatgggaacctctcccatgttaagatgatggcttcctctgcccccctctgccatctcagtggcacggttctacagcagggcaccagagttgggacggcagccctcagtgcctgccatggactgactggatttttccaactaccacatggagactttttcattgaacccgtgaagaagcatccactggttgagggagggtaccacccgcacatcgtttacaggaggcagaaagttccagaaaccaaggagccaacctgtggattaaagggtattgtgactcacatgtcctcctgggttgaagaatctgttttgttcttttggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - OTU domain, ubiquitin aldehyde binding 2 - ATPase, H+ transporting V0 subunit e2 - chromosome 10 open reading frame 104 - endoplasmic reticulum metallopeptidase 1 |