Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C10orf104-chromosome 10 open reading frame 104 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C10orf104-chromosome 10 open reading frame 104 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009530 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C10orf104 |
| Origin species: | Human |
| Product name: | C10orf104-chromosome 10 open reading frame 104 Gene |
| Size: | 2ug |
| Accessions: | BC009530 |
| Gene id: | 119504 |
| Gene description: | chromosome 10 open reading frame 104 |
| Synonyms: | C10orf104; APC16; CENP-27; MSAG; bA570G20.3; anaphase-promoting complex subunit 16; centromere protein 27; cyclosome subunit 16; metabolic syndrome-associated protein; anaphase promoting complex subunit 16 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcttcatcatcatcctcctcagctggtggggtcagtggaagttctgtcactggatctggtttcagtgtctcagaccttgccccaccacggaaagcccttttcacctaccccaaaggagctggagagatgttagaagatggctctgagagattcctctgcgaatctgtttttagctatcaagtggcatccacgcttaaacaggtgaaacatgatcagcaagttgctcggatggaaaaactagctggtttggtagaagagctggaggctgacgagtggcggtttaagcccatcgagcagctgctgggattcaccccctcttcaggttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - endoplasmic reticulum metallopeptidase 1 - coiled-coil and C2 domain containing 1B - regulator of G-protein signaling 2, 24kDa - C-type lectin domain family 4, member D |