C10orf104-chromosome 10 open reading frame 104 Gene View larger

C10orf104-chromosome 10 open reading frame 104 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf104-chromosome 10 open reading frame 104 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf104-chromosome 10 open reading frame 104 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009530
Product type: DNA & cDNA
Ncbi symbol: C10orf104
Origin species: Human
Product name: C10orf104-chromosome 10 open reading frame 104 Gene
Size: 2ug
Accessions: BC009530
Gene id: 119504
Gene description: chromosome 10 open reading frame 104
Synonyms: C10orf104; APC16; CENP-27; MSAG; bA570G20.3; anaphase-promoting complex subunit 16; centromere protein 27; cyclosome subunit 16; metabolic syndrome-associated protein; anaphase promoting complex subunit 16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcttcatcatcatcctcctcagctggtggggtcagtggaagttctgtcactggatctggtttcagtgtctcagaccttgccccaccacggaaagcccttttcacctaccccaaaggagctggagagatgttagaagatggctctgagagattcctctgcgaatctgtttttagctatcaagtggcatccacgcttaaacaggtgaaacatgatcagcaagttgctcggatggaaaaactagctggtttggtagaagagctggaggctgacgagtggcggtttaagcccatcgagcagctgctgggattcaccccctcttcaggttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - endoplasmic reticulum metallopeptidase 1
- coiled-coil and C2 domain containing 1B
- regulator of G-protein signaling 2, 24kDa
- C-type lectin domain family 4, member D

Buy C10orf104-chromosome 10 open reading frame 104 Gene now

Add to cart