ERMP1-endoplasmic reticulum metallopeptidase 1 Gene View larger

ERMP1-endoplasmic reticulum metallopeptidase 1 Gene

PTXBC031630

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ERMP1-endoplasmic reticulum metallopeptidase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ERMP1-endoplasmic reticulum metallopeptidase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031630
Product type: DNA & cDNA
Ncbi symbol: ERMP1
Origin species: Human
Product name: ERMP1-endoplasmic reticulum metallopeptidase 1 Gene
Size: 2ug
Accessions: BC031630
Gene id: 79956
Gene description: endoplasmic reticulum metallopeptidase 1
Synonyms: FXNA; KIAA1815; bA207C16.3; endoplasmic reticulum metallopeptidase 1; Felix-ina; aminopeptidase Fxna; bA207C16.3 (novel protein similar to predicted yeast, plant and worm proteins)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttattccttatctttatgcattgtacctcatctgggcagtatttgagatgtttacccctatcctcgggagaagtggttctgaaatcccacctgatgttgtgctggcatccattttggctggctgtacaatgattctctcgtcctattttattaacttcatctaccttgccaagagcacaaaaaaaaccatgctaactttaactttggtatgtgcaattacattcctccttgtttgcagtggaacattttttccatatagctccaatcctgctaatccgaagccaaagagagtgtttcttcagcatatgactagaacattccatgacttggaaggaaatgcagttaaacgggactctggaatatggatcaatgggtttgattatactggaatttctcacataacccctcacattcctgagatcaatgatagtatccgagctcactgtgaggagaatgcacctctttgtggttttccttggtatcttccagtgcactttctgatcaggaaaaactggtatcttcctgccccagaagtttctccaagaaatcctcctcatttccgactcatatccaaagaacagacaccttgggattctataaaattgacttttgaagcaacaggaccaagccatatgtccttctatgttcgagcccacaaagggtcaacactttctcagtggtctcttggcaatggcaccccagtcacaagtaaaggaggagactactttgtcttttactcccatggactccaggcctctgcatggcagttctggatagaagtgcaggtttcagaagaacatcctgaaggaatggtcaccgtggccattgctgcccactatctgtctggggaagacaagagatcccctcaactggatgctctgaaggaaaagttcccagattggacatttccctctgcctgggtgtgcacctacgatctctttgtattttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil and C2 domain containing 1B
- regulator of G-protein signaling 2, 24kDa
- C-type lectin domain family 4, member D
- trafficking protein particle complex 4

Buy ERMP1-endoplasmic reticulum metallopeptidase 1 Gene now

Add to cart