Login to display prices
Login to display prices
ERMP1-endoplasmic reticulum metallopeptidase 1 Gene View larger

ERMP1-endoplasmic reticulum metallopeptidase 1 Gene

PTXBC031630

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ERMP1-endoplasmic reticulum metallopeptidase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ERMP1-endoplasmic reticulum metallopeptidase 1 Gene

Proteogenix catalog: PTXBC031630
Ncbi symbol: ERMP1
Product name: ERMP1-endoplasmic reticulum metallopeptidase 1 Gene
Size: 2ug
Accessions: BC031630
Gene id: 79956
Gene description: endoplasmic reticulum metallopeptidase 1
Synonyms: FXNA; KIAA1815; bA207C16.3; endoplasmic reticulum metallopeptidase 1; Felix-ina; aminopeptidase Fxna; bA207C16.3 (novel protein similar to predicted yeast, plant and worm proteins)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttattccttatctttatgcattgtacctcatctgggcagtatttgagatgtttacccctatcctcgggagaagtggttctgaaatcccacctgatgttgtgctggcatccattttggctggctgtacaatgattctctcgtcctattttattaacttcatctaccttgccaagagcacaaaaaaaaccatgctaactttaactttggtatgtgcaattacattcctccttgtttgcagtggaacattttttccatatagctccaatcctgctaatccgaagccaaagagagtgtttcttcagcatatgactagaacattccatgacttggaaggaaatgcagttaaacgggactctggaatatggatcaatgggtttgattatactggaatttctcacataacccctcacattcctgagatcaatgatagtatccgagctcactgtgaggagaatgcacctctttgtggttttccttggtatcttccagtgcactttctgatcaggaaaaactggtatcttcctgccccagaagtttctccaagaaatcctcctcatttccgactcatatccaaagaacagacaccttgggattctataaaattgacttttgaagcaacaggaccaagccatatgtccttctatgttcgagcccacaaagggtcaacactttctcagtggtctcttggcaatggcaccccagtcacaagtaaaggaggagactactttgtcttttactcccatggactccaggcctctgcatggcagttctggatagaagtgcaggtttcagaagaacatcctgaaggaatggtcaccgtggccattgctgcccactatctgtctggggaagacaagagatcccctcaactggatgctctgaaggaaaagttcccagattggacatttccctctgcctgggtgtgcacctacgatctctttgtattttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: