ATP6V0E2-ATPase, H+ transporting V0 subunit e2 Gene View larger

ATP6V0E2-ATPase, H+ transporting V0 subunit e2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP6V0E2-ATPase, H+ transporting V0 subunit e2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6V0E2-ATPase, H+ transporting V0 subunit e2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015899
Product type: DNA & cDNA
Ncbi symbol: ATP6V0E2
Origin species: Human
Product name: ATP6V0E2-ATPase, H+ transporting V0 subunit e2 Gene
Size: 2ug
Accessions: BC015899
Gene id: 155066
Gene description: ATPase, H+ transporting V0 subunit e2
Synonyms: ATP6V0E2L; C7orf32; V-type proton ATPase subunit e 2; ATPase, H+ transporting V0 subunit E isoform 2-like; H+-ATPase e2 subunit; V-ATPase subunit e 2; lysosomal 9 kDa H(+)-transporting ATPase V0 subunit e2; vacuolar proton pump subunit e 2; vacuolar proton-ATPase subunit; ATPase H+ transporting V0 subunit e2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctgctccaatacccgcactgctctggagtttgccctctttcccaaggagatgctgctggggagctggtatgggtggggtctttccctttacagacggggcagatgccaggactcagcccatcctgaggaggacacgtgtcctcatggagagggtgctccggcccaggcgggggagtcggtgcccagtcagcagctctgccaccatcctgctgggaactgggggggcctctattgggttataggcaaggccttttctctggcatggaattgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 10 open reading frame 104
- endoplasmic reticulum metallopeptidase 1
- coiled-coil and C2 domain containing 1B
- regulator of G-protein signaling 2, 24kDa

Buy ATP6V0E2-ATPase, H+ transporting V0 subunit e2 Gene now

Add to cart