Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VPS37C-vacuolar protein sorting 37 homolog C (S. cerevisiae) Gene
PTXBC141827
New product
Data sheet of VPS37C-vacuolar protein sorting 37 homolog C (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VPS37C-vacuolar protein sorting 37 homolog C (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC141827 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VPS37C |
| Origin species: | Human |
| Product name: | VPS37C-vacuolar protein sorting 37 homolog C (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC141827 |
| Gene id: | 55048 |
| Gene description: | vacuolar protein sorting 37 homolog C (S. cerevisiae) |
| Synonyms: | VPS37C, ESCRT-I subunit; ESCRT-I complex subunit VPS37C; vacuolar protein sorting-associated protein 37C; hVps37C; vacuolar protein sorting 37 homolog C; vacuolar protein sorting 37C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagacgctgaaggataagaccctgcaggagctggaggagttgcagaatgactcggaggcgattgaccagctggccctggagtcccctgaggtccaggacctacagctggaacgggagatggcactggccaccaaccggagcctggcagagcggaacttggagttccagggtcccctggagatcagccgctcaaacctctcggatagataccaggagctccggaagctcgtggagcggtgccaggagcagaaggcaaagctggagaaattttcttcagcactgcagccagggaccttgttagaccttctgcaggtggaaggcatgaagatcgaagaagagtccgaggccatggctgagaagttcctggagggcgaggtgcccctggaaacgttcctggagaatttttcctccatgaggatgctgtcccacctgcgccgggttcgcgtggaaaagctccaggaagtggtgaggaagcccagggcttcccaggagctggccggcgatgcccctccaccccgtccaccacccccggtgcgcccagtcccccagggaacaccccctgtggttgaagagcagccgcagccaccatcagccatgcctccctaccctttgccctacagcccatcccccagcctgcctgtgggccccactgcccatggagccctgccaccggcccctttcccagtagtgtcccagccctccttctacagcgggcctctgggccccacttacccggcagcccagcttggacccaggggtgctgcgggttactcctggtccccacagaggagcatgccaccccggccgggctatcctgggaccccaatgggtgcctctgggcctgggtaccccttgcggggaggcagggcccccagtcctggttatcctcaacagtccccataccccgcaacaggaggaaaacctccctacccaatacagcctcagctccccagctttccaggccagccccagccctcagtgcccctgcagcccccttatccccccgggcccgcccctccctatgggttcccaccaccgccggggcctgcctggcctgggtattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Fc fragment of IgG, low affinity IIb, receptor (CD32) - microtubule-associated protein 1 light chain 3 beta - SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) - RNA binding motif, single stranded interacting protein |