ERCC2-excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene View larger

ERCC2-excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene


New product

Data sheet of ERCC2-excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ERCC2-excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC110523
Product type: DNA & cDNA
Ncbi symbol: ERCC2
Origin species: Human
Product name: ERCC2-excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene
Size: 2ug
Accessions: BC110523
Gene id: 2068
Gene description: excision repair cross-complementing rodent repair deficiency, complementation group 2
Synonyms: COFS2; EM9; TFIIH; TTD; TTD1; XPD; TFIIH basal transcription factor complex helicase XPD subunit; BTF2 p80; CXPD; DNA excision repair protein ERCC-2; DNA repair protein complementing XP-D cells; TFIIH 80 kDa subunit; TFIIH basal transcription factor complex 80 kDa subunit; TFIIH basal transcription factor complex helicase XPB subunit; TFIIH basal transcription factor complex helicase subunit; TFIIH p80; basic transcription factor 2 80 kDa subunit; excision repair cross-complementation group 2; excision repair cross-complementing rodent repair deficiency, complementation group 2; xeroderma pigmentosum complementary group D; xeroderma pigmentosum group D-complementing protein; ERCC excision repair 2, TFIIH core complex helicase subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctcaacgtggacgggctcctggtctacttcccgtacgactacatctaccccgagcagttctcctacatgcgggagctcaaacgcacgctggacgccaagggtcatggagtcctggagatgccctcaggcaccgggaagacagtatccctgttggccctgatcatggcataccagagagcatatccgctggaggtgaccaaactcatctactgctcaagaactgtgccagagattgagaaggtgattgaagagcttcgaaagttgctcaacttctatgagaagcaggagggcgagaagctgccgtttctgggactggctctgagctcccgcaaaaacttgtgtattcaccctgaggtgacacccctgcgctttgggaaggacgtcgatgggaaatgccacagcctcacagcctcctatgtgcgggcgcagtaccagcatgacaccagcctgccccactgccgattctatgaggaatttgatgcccatgggcgtgaggtgcccctccccgctggcatctacaacctggatgacctgaaggccctggggcggcgccagggctggtgcccatacttccttgctcgatactcaatcctgcatgccaatgtggtggtttatagctaccactacctcctggaccccaagattgcagacctggtgtccaaggaactggcccgcaaggccgtcgtggtcttcgacgaggcccacaacattgacaacgtctgcatcgactccatgagcgtcaacctcacccgccggacccttgaccggtgccagggcaacctggagaccctgcagaagacggtgctcaggatcaaagagacagacgagcagcgcctgcgggacgagtaccggcgtctggtggaggggctgcgggaggccagcgccgcccgggagacggacgcccacctggccaaccccgtgctgcccgacgaagtgctgcaggaggcagtgcctggctccatccgcacggccgagcatttcctgggcttcctgaggcggctgctggagtacgtgaagtggcggctgcgtgtgcagcatgtggtgcaggagagcccgcccgccttcctgagcggcctggcccagcgcgtgtgcatccagcgcaagcccctcagattctgtgctgaacgcctccggtccctgctgcatactctggagatcaccgaccttgctgacttctccccgctcaccctccttgctaactttgccacccttgtcagcacctacgccaaaggcttcaccatcatcatcgagccctttgacgacagaaccccgaccattgccaaccccatcctgcacttcagctgcatggacgcctcgctggccatcaaacccgtatttgagcgtttccagtctgtcatcatcacatctgggacactgtccccgctggacatctaccccaagatcctggacttccaccccgtcaccatggcaaccttcaccatgacgctggcacgggtctgcctctgccctatgatcatcggccgtggcaatgaccaggtggccatcagctccaaatttgagacccgggaggatattgctgtgatccggaactatgggaacctcctgctggagatgtccgctgtggtccctgatggcatcgtggccttcttcaccagctaccagtacatggagagcaccgtggcctcctggtatgagcaggggatccttgagaacatccagaggaacaagctgctctttattgagacccaggatggtgccgaaaccagtgtcgccctggagaagtaccaggaggcctgcgagaatggccgcggggccatcctgctgtcagtggcccggggcaaagtgtccgagggaatcgactttgtgcaccactacgggcgggccgtcatcatgtttggcgtcccctacgtctacacacagagccgcattctcaaggcgcggctggaatacctgcgggaccagttccagattcgtgagaatgactttcttaccttcgatgccatgcgccacgcggcccagtgtgtgggtcgggccatcaggggcaagacggactacggcctcatggtctttgccgacaagcggtttgcccgtggggacaagcgggggaagctgccccgctggatccaggagcacctcacagatgccaacctcaacctgaccgtggacgagggtgtccaggtggccaagtacttcctgcggcagatggcacagcccttccaccgggaggatcagctgggcctgtccctgctcagcctggagcagctagaatcagaggagacgctgcagaggatagagcagattgctcagcagctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine rich repeat and fibronectin type III domain containing 4
- ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
- chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
- translocase of inner mitochondrial membrane 8 homolog B (yeast)