Cart 1 Product Products 121,50 € (empty)
-
1 x TRIM15-tri...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
TIMM50-translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) Gene
PTXBC121147
New product
Data sheet of TIMM50-translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMM50-translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121147 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM50 |
| Origin species: | Human |
| Product name: | TIMM50-translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC121147 |
| Gene id: | 92609 |
| Gene description: | translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) |
| Synonyms: | TIM50; TIM50L; mitochondrial import inner membrane translocase subunit TIM50; Tim50-like protein; homolog of yeast Tim50; translocase of inner mitochondrial membrane 50 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctcagctttatctctgggcaataagtgtgatcccttccttcgctgcgtcctttgcaggggcggtggcgctctgcaaggcccaagggggcgtggtccagatgactttgaatcccagttgtcgcccccagggtcagccaggagactagtcagaagcaaacgcgcctgcggcaatccgcccgatgcctttggtctctctcgggcttccgtccacccgcccctcccccgcgtttccattggctgtacctccggcccggggcgggcgaagagggagcgagtgggcggggccgcgtggcgtcagcgcaagatggcggcctcggcagcggtgttctcgcgcttgcgaagcgggctccggctcggctcgcggggactgtgcacgaggttggcgacgccgccccgccgggccccagatcaggccgcagagatcgggagccgcgggagcactaaggcgcaagggccacagcagcagccgggctcagagggtcccagctatgccaaaaaagttgcgctctggcttgctgggctgcttggagctggtgggactgtgagcgtcgtctatatctttggaaacaacccggtggacgaaaatggtgccaagattcctgatgagttcgacaatgatccaattctggtacagcagttgcgccggacatacaaatatttcaaagattatagacagatgatcatcgagcccaccagcccttgccttctcccagaccctctgcaggaaccgtactaccagccaccctacacgctcgttttggagctcaccggcgtcctcttgcatcctgagtggtcgctggccactggctggaggtttaagaagcgcccaggcatcgagaccttgttccagcagcttgcccctttatatgaaattgtcatctttacgtcagagactggcatgactgcgtttccactcattgatagtgtggacccccatggcttcatctcctaccgcctattccgggacgccacaagatacatggatggacaccatgtaaaggatatttcatgtctgaatcgggacccagctcgagtagtagttgtggactgcaagaaggaagccttccgcctgcagccctataacggcgttgccctgcggccctgggacggcaactctgatgaccgggtcttgttggatctgtctgccttcctcaagaccattgcactgaatggtgtggaggacgtgcgaaccgtgctggagcactatgccctggaggatgacccgctggcggctttcaaacagcggcaaagccggctagagcaggaggagcagcagcgcctggccgagctctccaagtccaacaagcagaacctcttccttggctccctcaccagccgcttgtggcctcgctccaaacagccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) - succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 2 - split hand/foot malformation (ectrodactyly) type 1 - RanBP-type and C3HC4-type zinc finger containing 1 |