Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNAB3-potassium voltage-gated channel, shaker-related subfamily, beta member 3 Gene
PTXBC099634
New product
Data sheet of KCNAB3-potassium voltage-gated channel, shaker-related subfamily, beta member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNAB3-potassium voltage-gated channel, shaker-related subfamily, beta member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC099634 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNAB3 |
| Origin species: | Human |
| Product name: | KCNAB3-potassium voltage-gated channel, shaker-related subfamily, beta member 3 Gene |
| Size: | 2ug |
| Accessions: | BC099634 |
| Gene id: | 9196 |
| Gene description: | potassium voltage-gated channel, shaker-related subfamily, beta member 3 |
| Synonyms: | AKR6A9; KCNA3.1B; KV-BETA-3; voltage-gated potassium channel subunit beta-3; K(+) channel subunit beta-3; potassium channel, voltage gated subfamily A regulatory beta subunit 3; potassium channel, voltage-dependent, beta-3 subunit; potassium voltage-gated channel, shaker-related subfamily, beta member 3; potassium voltage-gated channel subfamily A regulatory beta subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggtgtctatcgcgtgtaccgagcagaaccttcgcagccggagcagtgaggaccgtctgtgtggaccccggccgggccccgggggcggtaatggtgggccggccggcggggggcacgggaatcctccggggggtggagggtctggccccaaggcccgagctgcactggttccccgacccccagcgcccgctggggccctccgagagagcaccggccgaggcactggcatgaaatacaggaacctagggaagtctggtcttcgggtatcctgtcttggcctaggtacctgggtcacatttggttctcagatctcagatgagacagcagaggatgtgctgactgtagcctatgagcatggtgtaaacctgtttgacaccgccgaagtgtacgcagcaggaaaggctgaaagaaccctagggaacatcctcaagagcaaaggttggaggagatcaagctatgtcatcactaccaagattttttggggaggacaggcagaaaccgagcgaggtttaagccgaaagcacatcattgagggcttgcgaggatccctggaacgcctccagctgggatacgtggacattgtctttgccaatcgctcagaccccaactgtcctatggaggagattgtgcgagccatgacctatgtcatcaaccagggcctggccctatactgggggacatcccgatggggggctgcagaaatcatggaggcctactccatggccagacagttcaatctgattcctccagtgtgtgaacaagcggagcaccatctgtttcagagggagaaggtggagatgcagctgccagagctctaccacaagattggagttggatcagtcacttggtaccctctagcctgtggtctcattactagcaagtatgatgggcgagtcccagatacttgcagggcctccatcaagggctaccagtggctcaaggacaaagtgcagagtgaagatggcaagaagcaacaagccaaagtcatggaccttcttcctgtcgctcaccagctgggctgcaccgtggcccagcttgctattgcgtggtgtctccgcagtgagggtgtcagctctgtcttgctgggggtgtcgagtgcggagcagttgatagaacacctgggcgcgctacaggtgctgagccagctgaccccgcagacagtgatggaaatagacgggctcctgggaaacaagccgcattccaagaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) - regulation of nuclear pre-mRNA domain containing 1B - TIA1 cytotoxic granule-associated RNA binding protein - ChaC, cation transport regulator homolog 1 (E. coli) |