No products
Prices are tax excluded
PTXBC001279
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC001279 |
Product type: | DNA & cDNA |
Ncbi symbol: | MFAP3L |
Origin species: | Human |
Product name: | MFAP3L-microfibrillar-associated protein 3-like Gene |
Size: | 2ug |
Accessions: | BC001279 |
Gene id: | 9848 |
Gene description: | microfibrillar-associated protein 3-like |
Synonyms: | NYD-sp9; microfibrillar-associated protein 3-like; microfi brillar-associated protein 3-like; testis development protein NYD-SP9; microfibrillar associated protein 3 like |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggatcgattgaagagccatctgactgtgtgctttctaccttctgtgccctttttaatcctagtatccactctagccaccgctaagagtgtgactaacagcactttaaatggcactaacgtggtcttgggctctgtgcccgtaatcattgccagaactgaccatatcatagtcaaggaagggaacagtgccttgattaactgtagtgtttatggcatccctgacccacagttcaagtggtataattccattggcaagctgctgaaagaagaagaggatgagaaggagagaggaggaggtaggctttaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - neuropilin (NRP) and tolloid (TLL)-like 2 - zinc finger and BTB domain containing 24 - emopamil binding protein (sterol isomerase) - splicing factor, arginine/serine-rich 16 |