Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of EBP-emopamil binding protein (sterol isomerase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EBP-emopamil binding protein (sterol isomerase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001549 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EBP |
| Origin species: | Human |
| Product name: | EBP-emopamil binding protein (sterol isomerase) Gene |
| Size: | 2ug |
| Accessions: | BC001549 |
| Gene id: | 10682 |
| Gene description: | emopamil binding protein (sterol isomerase) |
| Synonyms: | CDPX2; CHO2; CPX; CPXD; MEND; 3-beta-hydroxysteroid-Delta(8),Delta(7)-isomerase; 3-beta-hydroxysteroid-delta-8,delta-7-isomerase; Chondrodysplasia punctata-2, X-linked dominant (Happle syndrome); D8-D7 sterol isomerase; cholestenol Delta-isomerase; delta(8)-Delta(7) sterol isomerase; emopamil-binding protein; sterol 8-isomerase; emopamil binding protein (sterol isomerase) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactaccaacgcgggccccttgcacccatactggcctcagcacctaagactggacaactttgtacctaatgaccgccccacctggcatatactggctggcctcttctctgtcacaggggtcttagtcgtgaccacatggctgttgtcaggtcgtgctgcggttgtcccattggggacttggcggcgactgtccctgtgctggtttgcagtgtgtgggttcattcacctggtgatcgagggctggttcgttctctactacgaagacctgcttggagaccaagccttcttatctcaactctggaaagagtatgccaagggagacagccgatacatcctgggtgacaacttcacagtgtgcatggaaaccatcacagcttgcctgtggggaccactcagcctgtgggtggtgatcgcctttctccgccagcatcccctccgcttcattctacagcttgtggtctctgtgggccagatctatggggatgtgctctacttcctgacagagcaccgcgacggattccagcacggagagctgggccaccctctctacttctggttttactttgtcttcatgaatgccctgtggctggtgctgcctggagtccttgtgcttgatgctgtgaagcacctcactcatgcccagagcacgctggatgccaaggccacaaaagccaagagcaagaagaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - splicing factor, arginine/serine-rich 16 - BRCA1/BRCA2-containing complex, subunit 3 - peptidylprolyl isomerase G (cyclophilin G) - zinc finger and BTB domain containing 22 |