Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SFRS16-splicing factor, arginine/serine-rich 16 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SFRS16-splicing factor, arginine/serine-rich 16 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013178 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SFRS16 |
| Origin species: | Human |
| Product name: | SFRS16-splicing factor, arginine/serine-rich 16 Gene |
| Size: | 2ug |
| Accessions: | BC013178 |
| Gene id: | 11129 |
| Gene description: | splicing factor, arginine/serine-rich 16 |
| Synonyms: | SFRS16; CLASP; SWAP2; CLK4-associating serine/arginine rich protein; Clk4 associating SR-related protein; splicing factor, arginine/serine-rich 16 (suppressor-of-white-apricot homolog, Drosophila); suppressor of white apricot homolog 2; CLK4 associating serine/arginine rich protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcgactacaagaagagggcggagcggagacgggagtattatgaaaagatcaagaaggacccagcccagttcctgcaggtacatggccgagcttgcaaggtgcacctggattctgcagtcgccctggccgctgagagccctgttaatatgatgccctggcagggggacaccaacaacatgattgaccgattcgatgtccgtgcccacctggaccacatccccgactacaccccccctctgctcaccaccatctccccagaacaggagtcggacgaacggaagtgtaactacgagcgctacagaggcctggtgcagaacgactttgccggcatctcagaggagcagtgcctgtaccagatctacattgatgagttgtacggaggcctccagagacccagcgaagatgagaagaagaagctggcagagaagaaggcttccatcggttatacctacgaggacctccagctcccgctccagctctcgctccagctcccgctctcgccgtggtgggggctactaccgttccggccgccacgcccgctcccggtcccgctcctggtcccgctcccgctcccgctcccggcgctattcccggtcccgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BRCA1/BRCA2-containing complex, subunit 3 - peptidylprolyl isomerase G (cyclophilin G) - zinc finger and BTB domain containing 22 - ankyrin repeat and SOCS box-containing 17 |