> >>NETO2-neuropilin (NRP) and tolloid (TLL)-like 2 Gene
NETO2-neuropilin (NRP) and tolloid (TLL)-like 2 Gene View larger

NETO2-neuropilin (NRP) and tolloid (TLL)-like 2 Gene

PTXBC012381

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of NETO2-neuropilin (NRP) and tolloid (TLL)-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NETO2-neuropilin (NRP) and tolloid (TLL)-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012381
Product type: DNA & cDNA
Ncbi symbol: NETO2
Origin species: Human
Product name: NETO2-neuropilin (NRP) and tolloid (TLL)-like 2 Gene
Size: 2ug
Accessions: BC012381
Gene id: 81831
Gene description: neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms: BTCL2; NEOT2; neuropilin and tolloid-like protein 2; brain-specific transmembrane protein containing 2 CUB and 1 LDL-receptor class A domains protein 2; neuropilin (NRP) and tolloid (TLL)-like 2; neuropilin and tolloid like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttgcaaaaccgcttttaataaaaccgggttccaagaagtgtttgatcctcctcattatgaactgttttcactaagggacaaagagatttctgcagacctggcagacttgtcggaagaattggacaactaccagaagatgcggcgctcctccaccgcctcccgctgcatccacgaccaccactgtgggtcgcaggcctccagcgtcaaacaaagcaggaccaacctcagttccatggaacttcctttccgaaatgactttgcacaaccacagccaatgaaaacatttaatagcaccttcaagaaaagtagttacactttcaaacagggacatgagtgccctgagcaggccctggaagaccgagtaatggaggagattccctgtgaaatttatgtcagggggcgagaagattctgcacaagcatccatatccattgacttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger and BTB domain containing 24
- emopamil binding protein (sterol isomerase)
- splicing factor, arginine/serine-rich 16
- BRCA1/BRCA2-containing complex, subunit 3

Reviews

Buy NETO2-neuropilin (NRP) and tolloid (TLL)-like 2 Gene now

Add to cart