Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CHP-calcium binding protein P22 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHP-calcium binding protein P22 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008373 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHP |
| Origin species: | Human |
| Product name: | CHP-calcium binding protein P22 Gene |
| Size: | 2ug |
| Accessions: | BC008373 |
| Gene id: | 11261 |
| Gene description: | calcium binding protein P22 |
| Synonyms: | calcium-binding protein CHP; CHP; SLC9A1BP; Sid470p; p22; p24; calcineurin B homologous protein 1; EF-hand calcium-binding domain-containing protein p22; SLC9A1 binding protein; calcineurin B homolog; calcineurin B-like protein; calcineurin homologous protein; calcium binding protein P22; calcium-binding protein p22; calcineurin like EF-hand protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtctcactctgtcacccaggctggagtgcagtggcgtgatcttggctcactgcaacctctgcctcctgggttcaagcaattctcccacctcagcctcccaagtagctgggattacagacgtgtgccaccatacctgggtaatttttgcatttttagtggagagggagtttcaccatgttggccaggttggtcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical LOC196872 - transmembrane protein 85 - DET1 and DDB1 associated 1 - transmembrane protein 93 |