MGC23270-hypothetical LOC196872 Gene View larger

MGC23270-hypothetical LOC196872 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC23270-hypothetical LOC196872 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGC23270-hypothetical LOC196872 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015579
Product type: DNA & cDNA
Ncbi symbol: MGC23270
Origin species: Human
Product name: MGC23270-hypothetical LOC196872 Gene
Size: 2ug
Accessions: BC015579
Gene id: 196872
Gene description: hypothetical LOC196872
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaatatcgagcagtgccccagaatccctgggttttgacacagtgcttcctcctcacctgaggcagcattcccaccctcctgcagggatctctccgaagagattcctctgcagagatctctggcccgcggagctcccttctccagcggtcagctcggcagtgagcggccccacatggccagagggcatctctgctcctgtgtttgggaagcagacccacgttccccagaggaccgggagccaggactgccactcctgcgaccccaccttaccagagtgggaaagaaaaatccctccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 85
- DET1 and DDB1 associated 1
- transmembrane protein 93
- PDZ domain containing 11

Buy MGC23270-hypothetical LOC196872 Gene now

Add to cart