Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6AP1-ATPase, H+ transporting, lysosomal accessory protein 1 Gene
PTXBC000724
New product
Data sheet of ATP6AP1-ATPase, H+ transporting, lysosomal accessory protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6AP1-ATPase, H+ transporting, lysosomal accessory protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000724 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6AP1 |
| Origin species: | Human |
| Product name: | ATP6AP1-ATPase, H+ transporting, lysosomal accessory protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC000724 |
| Gene id: | 537 |
| Gene description: | ATPase, H+ transporting, lysosomal accessory protein 1 |
| Synonyms: | 16A; ATP6IP1; ATP6S1; Ac45; CF2; VATPS1; XAP-3; XAP3; V-type proton ATPase subunit S1; ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1; ATPase, H+ transporting, lysosomal accessory protein 1; ATPase, H+ transporting, lysosomal interacting protein 1; H-ATPase subunit; V-ATPase Ac45 subunit; V-ATPase S1 accessory protein; V-ATPase subunit S1; protein XAP-3; vacuolar proton pump subunit S1; ATPase H+ transporting accessory protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatggcggccatggcgacggctcgagtgcggatggggccgcggtgcgcccaggcgctctggcgcatgccgtggctgccggtgtttttgtcgttggcggcggcggcggcggcggcagcggcggagcagcaggtcccgctggtgctgtggtcgagtgaccgggacttgtgggctcctgcggccgacactcatgaaggccacatcaccagcgacttgcagctctctacctacttagatcccgccctggagctgggtcccaggaatgtgctgctgttcctgcaggacaagctgagcattgaggatttcacagcatatggcggtgtgtttggaaacaagcaggacagcgccttttctaacctagagaatgccctggacctggccccctcctcactggtgcttcctgccgtcgactggtatgcagtcagcactctgaccacttacctgcaggagaagctcggggccagccccttgcatgtggacctggccaccctgcgggagctgaagctcaatgccagcctccctgctctgctgctcattcgcctgccctacacagccagctctggtctgatggcacccagggaagtcctcacaggcaacgatgaggtcatcgggcaggtcctgagcacactcaagtccgaagatgtcccatacacagcggccctcacagcggtccgcccttccagggtggcccgtgatgtagccgtggtggccggagggctaggtcgccagctgctacaaaaacagccagtatcacctgtgatccatcctcctgtgagttacaatgacaccgctccccggatcctgttctgggcccaaaacttctctgtggcgtacaaggaccagtgggaggacctgactcccctcacctttggggtgcaggaactcaacctgactggctccttctggaatgactcctttgccaggctctcactgacctatgaacgactctttggtaccacagtgacattcaagttcattctggccaaccgcctctacccagtgtctgcccggcactggtttaccatggagcgcctcgaagtccacagcaatggctccgtcgcctacttcaatgcttcccaggtcacagggcccagcatctactccttccactgcgagtatgtcagcagcctgagcaagaagggtagtctcctcgtggcccgcacgcagccctctccctggcagatgatgcttcaggacttccagatccaggctttcaacgtaatgggggagcagttctcctacgccagcgactgtgccagcttcttctcccccggcatctggatggggctgctcacctccctgttcatgctcttcatcttcacctatggcctgcacatgatcctcagcctcaagaccatggatcgctttgatgaccacaagggccccactatttctttgacccagattgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - papillary renal cell carcinoma (translocation-associated) - ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F - NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) - cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial |