Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V1F-ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F Gene
PTXBC104230
New product
Data sheet of ATP6V1F-ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V1F-ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104230 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V1F |
| Origin species: | Human |
| Product name: | ATP6V1F-ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F Gene |
| Size: | 2ug |
| Accessions: | BC104230 |
| Gene id: | 9296 |
| Gene description: | ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
| Synonyms: | ATP6S14; VATF; Vma7; V-type proton ATPase subunit F; ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F; ATPase, vacuolar, 14 kD; H(+)-transporting two-sector ATPase, 14kD subunit; V-ATPase 14 kDa subunit; V-ATPase F subunit; V-ATPase subunit F; adenosinetriphosphatase 14k chain; vacuolar ATP synthase subunit F; vacuolar proton pump F subunit; vacuolar proton pump subunit F; ATPase H+ transporting V1 subunit F |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggggaggggtaagctcatcgcagtgatcggagacgaggacacggtgactggtttcctgctgggcggcataggggagcttaacaagaaccgccatcccaatttcctggtggtggagaaggatacaaccatcaatgagatcgaagacactttccggcaatttctaaaccgggatgacattggcatcatcctcatcaaccagtacatcgcagagatggtgcggcatgccctggacgcccaccagcagtccatccccgctgtcctggagatcccctccaaggagcacccatatgacgccgccaaggactccatcctgcgcagggccaggggcatgttcactgccgaagacctgcgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) - cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial - MMS19 nucleotide excision repair homolog (S. cerevisiae) - glutamate receptor, ionotropic, N-methyl D-aspartate 2B |