Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NFU1-NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) Gene
PTXBC113692
New product
Data sheet of NFU1-NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NFU1-NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113692 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NFU1 |
| Origin species: | Human |
| Product name: | NFU1-NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC113692 |
| Gene id: | 27247 |
| Gene description: | NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) |
| Synonyms: | NFU1 iron-sulfur cluster scaffold; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial; CGI-33; HIRIP; MMDS1; NIFUC; Nfu; NifU; HIRA-interacting protein 5; NifU-like C-terminal domain containing; iron-sulfur cluster scaffold protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgacggccaggcggggctggggagctgcggctgttgccgccgggctgcgcaggcggttctgtcatatgttgaagaatccatacaccattaagaaacagcctctgcatcagtttgtacaaagaccacttttcccactacctgcagccttttatcacccagtgagatacatgtttattcaaacacaagataccccaaatccaaacagcttaaagtttataccaggaaaaccagttcttgagacaaggaccatggattttcccaccccagctgcagcatttcgctcccctctggctaggcagttatttaggattgaaggagtaaaaagtgtcttctttggaccagatttcatcactgtcacaaaggaaaatgaagaattagactggaatttactgaaaccagatatttatgcaacaatcatggacttctttgcatctggcttacccctggttactgaggaaacaccttcaggagaagcaggatctgaagaagatgatgaagttgtggcaatgattaaggaattgttagatactagaatacggccaactgtgcaggaagatggaggggatgtaatctacaaaggctttgaagatggcattgtacagctgaaactccagggttcttgtaccagctgccctagttcaatcattactctgaaaaatggaattcagaacatgctgcagttttatattccggaggtagaaggcgtagaacaggttatggatgatgaatcagatgaaaaagaagcaaactcaccttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial - MMS19 nucleotide excision repair homolog (S. cerevisiae) - glutamate receptor, ionotropic, N-methyl D-aspartate 2B - phosphoinositide-3-kinase, catalytic, alpha polypeptide |