HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene View larger

HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene

PTXBC013184

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013184
Product type: DNA & cDNA
Ncbi symbol: HLA-DPB1
Origin species: Human
Product name: HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene
Size: 2ug
Accessions: BC013184
Gene id: 3115
Gene description: major histocompatibility complex, class II, DP beta 1
Synonyms: HLA-DP; HLA-DP1B; HLA-DPB; HLA class II histocompatibility antigen, DP beta 1 chain; HLA class II histocompatibility antigen, DP(W4) beta chain; HLA-DP histocompatibility type, beta-1 subunit; MHC HLA DPB1; MHC class II HLA-DP-beta-1; MHC class II antigen DPB1; major histocompatibility complex, class II, DP beta 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggttctgcaggtttctgcggccccccggacagtggctctgacggcgttactgatggtgctgctcacatctgtggtccagggcagggccactccagagaattacgtgtaccagggacggcaggaatgctacgcgtttaatgggacacagcgcttcctggagagatacatctacaaccgggaggagtacgcgcgcttcgacagcgacgtgggggagttccgggcggtgacggagctggggcggcctgctgcggagtactggaacagccagaaggacatcctggaggagaagcgggcagtgccggacagggtatgcagacacaactacgagctggacgaggccgtgaccctgcagcgccgagtccagcctaaggtgaacgtttccccctccaagaaggggcccctgcagcaccacaacctgcttgtctgccacgtgacagatttctacccaggcagcattcaagtccgatggttcctgaatggacaggaggaaacagctggggtcgtgtccaccaacctgatccgtaatggagactggaccttccagatcctggtgatgctggaaatgaccccccagcagggagacgtctacatctgccaagtggagcacaccagcctggacagtcctgtcaccgtggagtggaaggcacagtctgattctgcccagagtaagacattgacgggagctgggggcttcgtgctggggctcatcatctgtggagtgggcatcttcatgcacaggaggagcaagaaagttcaacgaggatctgcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, H+ transporting, lysosomal accessory protein 1
- papillary renal cell carcinoma (translocation-associated)
- ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F
- NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)

Buy HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene now

Add to cart